Incidental Mutation 'R5403:Usp17le'
ID430105
Institutional Source Beutler Lab
Gene Symbol Usp17le
Ensembl Gene ENSMUSG00000043073
Gene Nameubiquitin specific peptidase 17-like E
SynonymsGm6596, Dub3
MMRRC Submission 042974-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R5403 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location104768049-104777470 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 104769234 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 234 (I234V)
Ref Sequence ENSEMBL: ENSMUSP00000147776 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053464] [ENSMUST00000211384]
Predicted Effect probably damaging
Transcript: ENSMUST00000053464
AA Change: I234V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000051716
Gene: ENSMUSG00000043073
AA Change: I234V

DomainStartEndE-ValueType
Pfam:UCH 84 379 9e-54 PFAM
Pfam:UCH_1 85 362 2.3e-21 PFAM
low complexity region 408 417 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000211384
AA Change: I234V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik G T 17: 56,876,221 probably benign Het
Adamts6 A G 13: 104,352,815 D392G possibly damaging Het
Adcy8 C T 15: 64,716,152 V929I probably benign Het
Alkbh8 A G 9: 3,385,318 K537E probably benign Het
Anp32a A T 9: 62,341,993 I16F possibly damaging Het
Asb18 T C 1: 90,014,388 T64A probably benign Het
Bpifb4 A T 2: 153,943,992 I17F probably damaging Het
Brd7 G T 8: 88,357,541 Q148K probably damaging Het
Brinp1 A G 4: 68,792,964 W336R probably benign Het
Ccdc88b T A 19: 6,857,740 T38S unknown Het
Cd46 C T 1: 195,062,411 V340I possibly damaging Het
Cdr2 G A 7: 120,958,745 Q186* probably null Het
Ces1e T G 8: 93,208,612 D404A probably benign Het
Chd3 A T 11: 69,349,069 probably null Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Cntnap3 G A 13: 64,761,978 T771I possibly damaging Het
Cops8 C T 1: 90,606,620 probably benign Het
Csmd2 C T 4: 128,486,884 R2078C probably benign Het
Ddx50 A G 10: 62,647,030 S87P probably benign Het
Dlg2 A G 7: 92,431,002 T598A probably damaging Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Epha6 A T 16: 59,775,570 D919E probably damaging Het
Fam109a A G 5: 121,852,731 E52G possibly damaging Het
Fam196b A T 11: 34,403,058 T367S probably benign Het
Fndc9 C T 11: 46,237,714 S20L probably benign Het
Gpx6 A G 13: 21,317,643 E145G probably damaging Het
Hc A G 2: 35,057,434 Y23H probably damaging Het
Jmy G T 13: 93,441,396 Q755K probably benign Het
Krtap4-7 A T 11: 99,643,714 S108T unknown Het
Mgat5b T G 11: 116,948,657 I333S probably benign Het
Mkl2 A G 16: 13,401,013 T519A probably damaging Het
Naip6 G A 13: 100,300,077 A646V probably benign Het
Olfr1416 A T 1: 92,480,297 V108E possibly damaging Het
Olfr936 G T 9: 39,046,703 P239T probably damaging Het
Opn4 T C 14: 34,592,937 T460A probably benign Het
Otogl T A 10: 107,808,756 M1210L probably benign Het
Phf24 A T 4: 42,933,831 probably null Het
Ppargc1a G A 5: 51,462,825 probably benign Het
Ptprd G A 4: 75,954,168 R1355* probably null Het
Rad50 A G 11: 53,695,281 probably null Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Het
St5 A G 7: 109,556,905 S213P probably damaging Het
Tbcd C A 11: 121,560,743 N546K probably damaging Het
Tenm4 A G 7: 96,888,827 D1832G probably damaging Het
Tfap2e T C 4: 126,734,646 I172M probably benign Het
Tnip2 A G 5: 34,513,764 L45P probably damaging Het
Ttc3 T C 16: 94,459,844 V1396A probably benign Het
Ube2o A T 11: 116,548,807 I179N possibly damaging Het
Zfp106 T C 2: 120,534,781 T382A probably benign Het
Zfp607a A G 7: 27,879,319 K605E possibly damaging Het
Zmynd10 T A 9: 107,550,586 L363H possibly damaging Het
Other mutations in Usp17le
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00582:Usp17le APN 7 104768787 missense probably benign 0.00
IGL01974:Usp17le APN 7 104768435 missense probably benign
IGL02364:Usp17le APN 7 104768775 nonsense probably null
IGL02413:Usp17le APN 7 104769726 missense probably benign 0.39
IGL02433:Usp17le APN 7 104769201 missense probably benign 0.01
IGL02960:Usp17le APN 7 104768740 missense probably benign
IGL02984:Usp17le UTSW 7 104769104 missense probably benign 0.21
R0035:Usp17le UTSW 7 104769062 nonsense probably null
R0389:Usp17le UTSW 7 104768460 missense probably damaging 0.96
R0499:Usp17le UTSW 7 104768501 missense probably benign 0.02
R0567:Usp17le UTSW 7 104768898 missense possibly damaging 0.95
R0879:Usp17le UTSW 7 104769647 missense probably damaging 0.99
R0879:Usp17le UTSW 7 104769648 missense possibly damaging 0.46
R4840:Usp17le UTSW 7 104769770 missense probably benign 0.34
R5140:Usp17le UTSW 7 104769438 missense probably damaging 1.00
R6210:Usp17le UTSW 7 104769143 missense probably damaging 1.00
R7047:Usp17le UTSW 7 104768433 missense probably benign 0.02
R7157:Usp17le UTSW 7 104768489 missense probably benign 0.03
R7361:Usp17le UTSW 7 104768877 missense probably damaging 1.00
R7386:Usp17le UTSW 7 104768307 splice site probably null
R7997:Usp17le UTSW 7 104768839 missense possibly damaging 0.94
R8189:Usp17le UTSW 7 104769348 missense probably damaging 0.99
R8248:Usp17le UTSW 7 104769794 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TGGCTTCAGGTCAAGGAACTC -3'
(R):5'- CAATGCATGAATCCTGCCTTC -3'

Sequencing Primer
(F):5'- AACTTGTTACCCGTGAAGGC -3'
(R):5'- ATGCATGAATCCTGCCTTCAAGTG -3'
Posted On2016-09-06