Incidental Mutation 'R5403:Mgat5b'
ID430125
Institutional Source Beutler Lab
Gene Symbol Mgat5b
Ensembl Gene ENSMUSG00000043857
Gene Namemannoside acetylglucosaminyltransferase 5, isoenzyme B
SynonymsGnT-IX
MMRRC Submission 042974-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R5403 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location116918863-116986948 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 116948657 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Serine at position 333 (I333S)
Ref Sequence ENSEMBL: ENSMUSP00000099316 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103027]
Predicted Effect probably benign
Transcript: ENSMUST00000103027
AA Change: I333S

PolyPhen 2 Score 0.351 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000099316
Gene: ENSMUSG00000043857
AA Change: I333S

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:Glyco_transf_18 184 777 3.5e-269 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139905
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The MGAT5B gene encodes a beta-1,6-N-acetylglucosaminyltransferase (EC 2.4.1.155) that functions in the synthesis of complex cell surface N-glycans (Kaneko et al., 2003 [PubMed 14623122]).[supplied by OMIM, Nov 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit low levels of O-man-linked beta1,6-branched glycans. Mice homozygous for a different knock-out allele exhibit decreased susceptibility to cuprizone induced injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik G T 17: 56,876,221 probably benign Het
Adamts6 A G 13: 104,352,815 D392G possibly damaging Het
Adcy8 C T 15: 64,716,152 V929I probably benign Het
Alkbh8 A G 9: 3,385,318 K537E probably benign Het
Anp32a A T 9: 62,341,993 I16F possibly damaging Het
Asb18 T C 1: 90,014,388 T64A probably benign Het
Bpifb4 A T 2: 153,943,992 I17F probably damaging Het
Brd7 G T 8: 88,357,541 Q148K probably damaging Het
Brinp1 A G 4: 68,792,964 W336R probably benign Het
Ccdc88b T A 19: 6,857,740 T38S unknown Het
Cd46 C T 1: 195,062,411 V340I possibly damaging Het
Cdr2 G A 7: 120,958,745 Q186* probably null Het
Ces1e T G 8: 93,208,612 D404A probably benign Het
Chd3 A T 11: 69,349,069 probably null Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Cntnap3 G A 13: 64,761,978 T771I possibly damaging Het
Cops8 C T 1: 90,606,620 probably benign Het
Csmd2 C T 4: 128,486,884 R2078C probably benign Het
Ddx50 A G 10: 62,647,030 S87P probably benign Het
Dlg2 A G 7: 92,431,002 T598A probably damaging Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Epha6 A T 16: 59,775,570 D919E probably damaging Het
Fam109a A G 5: 121,852,731 E52G possibly damaging Het
Fam196b A T 11: 34,403,058 T367S probably benign Het
Fndc9 C T 11: 46,237,714 S20L probably benign Het
Gpx6 A G 13: 21,317,643 E145G probably damaging Het
Hc A G 2: 35,057,434 Y23H probably damaging Het
Jmy G T 13: 93,441,396 Q755K probably benign Het
Krtap4-7 A T 11: 99,643,714 S108T unknown Het
Mkl2 A G 16: 13,401,013 T519A probably damaging Het
Naip6 G A 13: 100,300,077 A646V probably benign Het
Olfr1416 A T 1: 92,480,297 V108E possibly damaging Het
Olfr936 G T 9: 39,046,703 P239T probably damaging Het
Opn4 T C 14: 34,592,937 T460A probably benign Het
Otogl T A 10: 107,808,756 M1210L probably benign Het
Phf24 A T 4: 42,933,831 probably null Het
Ppargc1a G A 5: 51,462,825 probably benign Het
Ptprd G A 4: 75,954,168 R1355* probably null Het
Rad50 A G 11: 53,695,281 probably null Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Het
St5 A G 7: 109,556,905 S213P probably damaging Het
Tbcd C A 11: 121,560,743 N546K probably damaging Het
Tenm4 A G 7: 96,888,827 D1832G probably damaging Het
Tfap2e T C 4: 126,734,646 I172M probably benign Het
Tnip2 A G 5: 34,513,764 L45P probably damaging Het
Ttc3 T C 16: 94,459,844 V1396A probably benign Het
Ube2o A T 11: 116,548,807 I179N possibly damaging Het
Usp17le T C 7: 104,769,234 I234V probably damaging Het
Zfp106 T C 2: 120,534,781 T382A probably benign Het
Zfp607a A G 7: 27,879,319 K605E possibly damaging Het
Zmynd10 T A 9: 107,550,586 L363H possibly damaging Het
Other mutations in Mgat5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Mgat5b APN 11 116931662 missense probably damaging 0.99
IGL01315:Mgat5b APN 11 116923389 missense probably damaging 1.00
IGL01432:Mgat5b APN 11 116973376 missense probably benign
IGL01480:Mgat5b APN 11 116978452 missense probably benign 0.00
IGL02573:Mgat5b APN 11 116977714 missense probably benign 0.01
IGL02627:Mgat5b APN 11 116983616 missense probably damaging 1.00
IGL03053:Mgat5b APN 11 116923450 missense possibly damaging 0.94
R0149:Mgat5b UTSW 11 116985139 splice site probably benign
R1175:Mgat5b UTSW 11 116977796 missense probably damaging 1.00
R1242:Mgat5b UTSW 11 116978404 missense probably benign 0.08
R1341:Mgat5b UTSW 11 116978397 missense probably benign 0.38
R1666:Mgat5b UTSW 11 116983648 missense probably benign 0.01
R1667:Mgat5b UTSW 11 116947377 missense probably benign 0.00
R1668:Mgat5b UTSW 11 116983648 missense probably benign 0.01
R1702:Mgat5b UTSW 11 116948659 missense possibly damaging 0.73
R1828:Mgat5b UTSW 11 116977788 missense probably damaging 1.00
R2019:Mgat5b UTSW 11 116947348 missense probably benign 0.07
R2102:Mgat5b UTSW 11 116919429 start gained probably benign
R2382:Mgat5b UTSW 11 116919496 missense probably damaging 0.99
R4995:Mgat5b UTSW 11 116974199 critical splice donor site probably null
R5028:Mgat5b UTSW 11 116985029 missense probably damaging 1.00
R5174:Mgat5b UTSW 11 116977715 missense probably benign 0.01
R5643:Mgat5b UTSW 11 116973400 missense probably damaging 0.99
R5644:Mgat5b UTSW 11 116973400 missense probably damaging 0.99
R7116:Mgat5b UTSW 11 116944959 missense possibly damaging 0.93
R7238:Mgat5b UTSW 11 116984983 missense probably benign 0.09
R7284:Mgat5b UTSW 11 116944920 missense probably damaging 0.96
R7440:Mgat5b UTSW 11 116968445 nonsense probably null
R7721:Mgat5b UTSW 11 116966801 missense
R8179:Mgat5b UTSW 11 116931728 missense probably benign 0.01
R8229:Mgat5b UTSW 11 116947387 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- ACAGACCTACGAGCTGCTTG -3'
(R):5'- AACGTGTGTCTGCATGGAAG -3'

Sequencing Primer
(F):5'- GCTTGCTGCTCTCCTCTGAC -3'
(R):5'- TGTGTCTGCATGGAAGAGGAAGC -3'
Posted On2016-09-06