Incidental Mutation 'R5403:Cntnap3'
ID 430128
Institutional Source Beutler Lab
Gene Symbol Cntnap3
Ensembl Gene ENSMUSG00000033063
Gene Name contactin associated protein-like 3
Synonyms
MMRRC Submission 042974-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.056) question?
Stock # R5403 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 64883996-65051769 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 64909792 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 771 (T771I)
Ref Sequence ENSEMBL: ENSMUSP00000089140 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091554]
AlphaFold E9PY62
Predicted Effect possibly damaging
Transcript: ENSMUST00000091554
AA Change: T771I

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000089140
Gene: ENSMUSG00000033063
AA Change: T771I

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
FA58C 33 180 4.88e-17 SMART
LamG 207 345 1.47e-11 SMART
LamG 394 525 1.43e-23 SMART
EGF 553 587 1.33e-1 SMART
FBG 590 775 6.76e-1 SMART
LamG 815 942 1.89e-32 SMART
EGF_like 963 999 6.28e1 SMART
LamG 1040 1178 9.46e-15 SMART
transmembrane domain 1245 1267 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222618
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the NCP family of cell-recognition molecules. This family represents a distinct subgroup of the neurexins. NCP proteins mediate neuron-glial interactions in vertebrates and glial-glial contact in invertebrates. The protein encoded by this gene may play a role in cell recognition within the nervous system. Alternatively spliced transcript variants encoding different isoforms have been described but their biological nature has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsbg3 G T 17: 57,183,221 (GRCm39) probably benign Het
Adamts6 A G 13: 104,489,323 (GRCm39) D392G possibly damaging Het
Adcy8 C T 15: 64,588,001 (GRCm39) V929I probably benign Het
Alkbh8 A G 9: 3,385,318 (GRCm39) K537E probably benign Het
Anp32a A T 9: 62,249,275 (GRCm39) I16F possibly damaging Het
Asb18 T C 1: 89,942,110 (GRCm39) T64A probably benign Het
Bpifb4 A T 2: 153,785,912 (GRCm39) I17F probably damaging Het
Brd7 G T 8: 89,084,169 (GRCm39) Q148K probably damaging Het
Brinp1 A G 4: 68,711,201 (GRCm39) W336R probably benign Het
Ccdc88b T A 19: 6,835,108 (GRCm39) T38S unknown Het
Cd46 C T 1: 194,744,719 (GRCm39) V340I possibly damaging Het
Cdr2 G A 7: 120,557,968 (GRCm39) Q186* probably null Het
Ces1e T G 8: 93,935,240 (GRCm39) D404A probably benign Het
Chd3 A T 11: 69,239,895 (GRCm39) probably null Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 105,036,102 (GRCm39) probably benign Het
Cops8 C T 1: 90,534,342 (GRCm39) probably benign Het
Csmd2 C T 4: 128,380,677 (GRCm39) R2078C probably benign Het
Ddx50 A G 10: 62,482,809 (GRCm39) S87P probably benign Het
Dennd2b A G 7: 109,156,112 (GRCm39) S213P probably damaging Het
Dlg2 A G 7: 92,080,210 (GRCm39) T598A probably damaging Het
Dnah8 G A 17: 30,967,542 (GRCm39) D2585N probably benign Het
Epha6 A T 16: 59,595,933 (GRCm39) D919E probably damaging Het
Fndc9 C T 11: 46,128,541 (GRCm39) S20L probably benign Het
Gpx6 A G 13: 21,501,813 (GRCm39) E145G probably damaging Het
Hc A G 2: 34,947,446 (GRCm39) Y23H probably damaging Het
Insyn2b A T 11: 34,353,058 (GRCm39) T367S probably benign Het
Jmy G T 13: 93,577,904 (GRCm39) Q755K probably benign Het
Krtap4-7 A T 11: 99,534,540 (GRCm39) S108T unknown Het
Mgat5b T G 11: 116,839,483 (GRCm39) I333S probably benign Het
Mrtfb A G 16: 13,218,877 (GRCm39) T519A probably damaging Het
Naip6 G A 13: 100,436,585 (GRCm39) A646V probably benign Het
Opn4 T C 14: 34,314,894 (GRCm39) T460A probably benign Het
Or6b2 A T 1: 92,408,019 (GRCm39) V108E possibly damaging Het
Or8g22 G T 9: 38,957,999 (GRCm39) P239T probably damaging Het
Otogl T A 10: 107,644,617 (GRCm39) M1210L probably benign Het
Pheta1 A G 5: 121,990,794 (GRCm39) E52G possibly damaging Het
Phf24 A T 4: 42,933,831 (GRCm39) probably null Het
Ppargc1a G A 5: 51,620,167 (GRCm39) probably benign Het
Ptprd G A 4: 75,872,405 (GRCm39) R1355* probably null Het
Rad50 A G 11: 53,586,108 (GRCm39) probably null Het
Robo4 CGG CG 9: 37,322,786 (GRCm39) probably null Het
Rsf1 GCG GCGACGGCGACG 7: 97,229,114 (GRCm39) probably benign Het
Tbcd C A 11: 121,451,569 (GRCm39) N546K probably damaging Het
Tenm4 A G 7: 96,538,034 (GRCm39) D1832G probably damaging Het
Tfap2e T C 4: 126,628,439 (GRCm39) I172M probably benign Het
Tnip2 A G 5: 34,671,108 (GRCm39) L45P probably damaging Het
Ttc3 T C 16: 94,260,703 (GRCm39) V1396A probably benign Het
Ube2o A T 11: 116,439,633 (GRCm39) I179N possibly damaging Het
Usp17le T C 7: 104,418,441 (GRCm39) I234V probably damaging Het
Zfp106 T C 2: 120,365,262 (GRCm39) T382A probably benign Het
Zfp607a A G 7: 27,578,744 (GRCm39) K605E possibly damaging Het
Zmynd10 T A 9: 107,427,785 (GRCm39) L363H possibly damaging Het
Other mutations in Cntnap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Cntnap3 APN 13 64,920,545 (GRCm39) missense probably damaging 1.00
IGL00782:Cntnap3 APN 13 64,893,619 (GRCm39) splice site probably benign
IGL00976:Cntnap3 APN 13 64,942,166 (GRCm39) missense probably damaging 1.00
IGL01319:Cntnap3 APN 13 64,935,651 (GRCm39) missense probably damaging 1.00
IGL01610:Cntnap3 APN 13 64,905,115 (GRCm39) missense probably damaging 0.98
IGL01861:Cntnap3 APN 13 64,946,922 (GRCm39) missense probably damaging 1.00
IGL02127:Cntnap3 APN 13 64,946,878 (GRCm39) splice site probably benign
IGL02133:Cntnap3 APN 13 64,899,487 (GRCm39) splice site probably benign
IGL02251:Cntnap3 APN 13 64,909,850 (GRCm39) missense probably damaging 1.00
IGL02272:Cntnap3 APN 13 64,905,225 (GRCm39) missense probably damaging 1.00
IGL02370:Cntnap3 APN 13 64,899,565 (GRCm39) missense probably benign
IGL02456:Cntnap3 APN 13 64,946,872 (GRCm39) splice site probably benign
IGL02589:Cntnap3 APN 13 64,940,244 (GRCm39) missense probably benign 0.08
IGL02695:Cntnap3 APN 13 64,919,946 (GRCm39) missense probably benign 0.01
IGL02850:Cntnap3 APN 13 64,905,223 (GRCm39) missense probably damaging 1.00
IGL03038:Cntnap3 APN 13 64,888,839 (GRCm39) missense possibly damaging 0.50
IGL03188:Cntnap3 APN 13 64,929,559 (GRCm39) missense probably damaging 0.97
IGL03327:Cntnap3 APN 13 65,035,582 (GRCm39) nonsense probably null
PIT4480001:Cntnap3 UTSW 13 64,905,024 (GRCm39) missense probably damaging 1.00
R0309:Cntnap3 UTSW 13 64,905,250 (GRCm39) splice site probably benign
R0422:Cntnap3 UTSW 13 64,905,099 (GRCm39) missense probably damaging 0.96
R0463:Cntnap3 UTSW 13 64,926,690 (GRCm39) missense probably damaging 1.00
R0491:Cntnap3 UTSW 13 64,909,859 (GRCm39) missense probably benign 0.01
R0499:Cntnap3 UTSW 13 65,006,492 (GRCm39) missense probably benign 0.33
R0550:Cntnap3 UTSW 13 64,909,814 (GRCm39) missense possibly damaging 0.86
R0613:Cntnap3 UTSW 13 64,906,228 (GRCm39) missense probably damaging 1.00
R0666:Cntnap3 UTSW 13 64,905,211 (GRCm39) missense probably damaging 1.00
R0840:Cntnap3 UTSW 13 64,935,724 (GRCm39) missense possibly damaging 0.94
R1577:Cntnap3 UTSW 13 64,906,104 (GRCm39) missense probably damaging 1.00
R1716:Cntnap3 UTSW 13 64,909,816 (GRCm39) missense probably damaging 1.00
R1732:Cntnap3 UTSW 13 64,888,626 (GRCm39) critical splice donor site probably null
R1739:Cntnap3 UTSW 13 64,888,406 (GRCm39) missense probably benign 0.17
R1905:Cntnap3 UTSW 13 65,051,578 (GRCm39) missense probably benign 0.04
R1988:Cntnap3 UTSW 13 64,906,204 (GRCm39) missense probably damaging 1.00
R2086:Cntnap3 UTSW 13 64,942,076 (GRCm39) missense possibly damaging 0.76
R3732:Cntnap3 UTSW 13 64,888,813 (GRCm39) missense possibly damaging 0.73
R3808:Cntnap3 UTSW 13 64,929,618 (GRCm39) missense probably damaging 0.96
R3809:Cntnap3 UTSW 13 64,929,618 (GRCm39) missense probably damaging 0.96
R4384:Cntnap3 UTSW 13 64,896,274 (GRCm39) missense probably damaging 1.00
R4433:Cntnap3 UTSW 13 64,926,667 (GRCm39) missense possibly damaging 0.92
R4631:Cntnap3 UTSW 13 64,926,697 (GRCm39) missense probably benign 0.04
R4645:Cntnap3 UTSW 13 64,926,602 (GRCm39) critical splice donor site probably null
R4702:Cntnap3 UTSW 13 64,926,676 (GRCm39) missense probably benign 0.17
R4876:Cntnap3 UTSW 13 64,935,520 (GRCm39) missense probably benign 0.00
R4994:Cntnap3 UTSW 13 64,909,798 (GRCm39) missense possibly damaging 0.55
R5043:Cntnap3 UTSW 13 64,942,162 (GRCm39) missense probably damaging 1.00
R5214:Cntnap3 UTSW 13 64,909,824 (GRCm39) missense probably damaging 1.00
R5571:Cntnap3 UTSW 13 65,051,572 (GRCm39) missense probably damaging 0.98
R5587:Cntnap3 UTSW 13 64,894,552 (GRCm39) missense probably damaging 1.00
R5695:Cntnap3 UTSW 13 64,935,769 (GRCm39) missense probably damaging 0.99
R5834:Cntnap3 UTSW 13 64,896,391 (GRCm39) missense probably benign 0.07
R5892:Cntnap3 UTSW 13 64,946,994 (GRCm39) missense probably damaging 1.00
R5950:Cntnap3 UTSW 13 64,935,583 (GRCm39) missense probably damaging 1.00
R6526:Cntnap3 UTSW 13 64,929,702 (GRCm39) missense possibly damaging 0.96
R6954:Cntnap3 UTSW 13 64,896,373 (GRCm39) missense probably benign 0.00
R7138:Cntnap3 UTSW 13 64,929,539 (GRCm39) critical splice donor site probably null
R7355:Cntnap3 UTSW 13 64,919,776 (GRCm39) missense probably benign
R7425:Cntnap3 UTSW 13 64,906,066 (GRCm39) missense probably damaging 1.00
R7521:Cntnap3 UTSW 13 64,919,815 (GRCm39) missense probably benign 0.22
R7719:Cntnap3 UTSW 13 64,920,591 (GRCm39) nonsense probably null
R7810:Cntnap3 UTSW 13 64,941,122 (GRCm39) missense possibly damaging 0.73
R7871:Cntnap3 UTSW 13 65,051,587 (GRCm39) missense probably benign 0.00
R8259:Cntnap3 UTSW 13 64,935,681 (GRCm39) missense probably damaging 0.99
R8415:Cntnap3 UTSW 13 64,886,479 (GRCm39) missense probably benign 0.31
R8491:Cntnap3 UTSW 13 64,933,157 (GRCm39) missense probably damaging 1.00
R9086:Cntnap3 UTSW 13 64,929,573 (GRCm39) missense probably damaging 1.00
R9087:Cntnap3 UTSW 13 64,899,532 (GRCm39) missense probably damaging 0.96
R9398:Cntnap3 UTSW 13 65,051,648 (GRCm39) missense probably benign 0.41
R9475:Cntnap3 UTSW 13 64,946,949 (GRCm39) missense probably damaging 1.00
R9625:Cntnap3 UTSW 13 65,006,579 (GRCm39) missense probably damaging 1.00
R9679:Cntnap3 UTSW 13 64,899,562 (GRCm39) missense probably damaging 1.00
Z1176:Cntnap3 UTSW 13 64,940,202 (GRCm39) missense probably damaging 0.98
Z1176:Cntnap3 UTSW 13 64,888,686 (GRCm39) frame shift probably null
Z1177:Cntnap3 UTSW 13 64,929,706 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGACAAAGCTTTCACACCTCAG -3'
(R):5'- CTGAGACTAATCTTGAAAGAGCAG -3'

Sequencing Primer
(F):5'- CCTGAACGTTAAAGGCTTGGTTACC -3'
(R):5'- GAAAGAGCAGTAATTGCTTCAT -3'
Posted On 2016-09-06