Mutagenetix > Incidental Mutations

Incidental Mutation 'R5403:Cntnap3'

430128

Institutional Source

Beutler Lab

Gene Symbol

Cntnap3

Ensembl Gene

ENSMUSG00000033063

Gene Name

contactin associated protein-like 3

Synonyms

MMRRC Submission

042974-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.052) question?

Stock #

R5403 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

64736182-64903955 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 64761978 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 771 (T771I)

Ref Sequence

ENSEMBL: ENSMUSP00000089140 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000091554]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000091554
AA Change: T771I

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000089140
Gene: ENSMUSG00000033063
AA Change: T771I

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
FA58C	33	180	4.88e-17	SMART
LamG	207	345	1.47e-11	SMART
LamG	394	525	1.43e-23	SMART
EGF	553	587	1.33e-1	SMART
FBG	590	775	6.76e-1	SMART
LamG	815	942	1.89e-32	SMART
EGF_like	963	999	6.28e1	SMART
LamG	1040	1178	9.46e-15	SMART
transmembrane domain	1245	1267	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222618

Coding Region Coverage

1x: 99.4%
3x: 98.7%
10x: 97.4%
20x: 95.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the NCP family of cell-recognition molecules. This family represents a distinct subgroup of the neurexins. NCP proteins mediate neuron-glial interactions in vertebrates and glial-glial contact in invertebrates. The protein encoded by this gene may play a role in cell recognition within the nervous system. Alternatively spliced transcript variants encoding different isoforms have been described but their biological nature has not been determined. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700061G19Rik	G	T	17: 56,876,221		probably benign	Het
Adamts6	A	G	13: 104,352,815	D392G	possibly damaging	Het
Adcy8	C	T	15: 64,716,152	V929I	probably benign	Het
Alkbh8	A	G	9: 3,385,318	K537E	probably benign	Het
Anp32a	A	T	9: 62,341,993	I16F	possibly damaging	Het
Asb18	T	C	1: 90,014,388	T64A	probably benign	Het
Bpifb4	A	T	2: 153,943,992	I17F	probably damaging	Het
Brd7	G	T	8: 88,357,541	Q148K	probably damaging	Het
Brinp1	A	G	4: 68,792,964	W336R	probably benign	Het
Ccdc88b	T	A	19: 6,857,740	T38S	unknown	Het
Cd46	C	T	1: 195,062,411	V340I	possibly damaging	Het
Cdr2	G	A	7: 120,958,745	Q186*	probably null	Het
Ces1e	T	G	8: 93,208,612	D404A	probably benign	Het
Chd3	A	T	11: 69,349,069		probably null	Het
Cmtm1	CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT	CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT	8: 104,309,470		probably benign	Het
Cops8	C	T	1: 90,606,620		probably benign	Het
Csmd2	C	T	4: 128,486,884	R2078C	probably benign	Het
Ddx50	A	G	10: 62,647,030	S87P	probably benign	Het
Dlg2	A	G	7: 92,431,002	T598A	probably damaging	Het
Dnah8	G	A	17: 30,748,568	D2585N	probably benign	Het
Epha6	A	T	16: 59,775,570	D919E	probably damaging	Het
Fam109a	A	G	5: 121,852,731	E52G	possibly damaging	Het
Fam196b	A	T	11: 34,403,058	T367S	probably benign	Het
Fndc9	C	T	11: 46,237,714	S20L	probably benign	Het
Gpx6	A	G	13: 21,317,643	E145G	probably damaging	Het
Hc	A	G	2: 35,057,434	Y23H	probably damaging	Het
Jmy	G	T	13: 93,441,396	Q755K	probably benign	Het
Krtap4-7	A	T	11: 99,643,714	S108T	unknown	Het
Mgat5b	T	G	11: 116,948,657	I333S	probably benign	Het
Mkl2	A	G	16: 13,401,013	T519A	probably damaging	Het
Naip6	G	A	13: 100,300,077	A646V	probably benign	Het
Olfr1416	A	T	1: 92,480,297	V108E	possibly damaging	Het
Olfr936	G	T	9: 39,046,703	P239T	probably damaging	Het
Opn4	T	C	14: 34,592,937	T460A	probably benign	Het
Otogl	T	A	10: 107,808,756	M1210L	probably benign	Het
Phf24	A	T	4: 42,933,831		probably null	Het
Ppargc1a	G	A	5: 51,462,825		probably benign	Het
Ptprd	G	A	4: 75,954,168	R1355*	probably null	Het
Rad50	A	G	11: 53,695,281		probably null	Het
Robo4	CGG	CG	9: 37,411,490		probably null	Het
Rsf1	GCG	GCGACGGCGACG	7: 97,579,907		probably benign	Het
St5	A	G	7: 109,556,905	S213P	probably damaging	Het
Tbcd	C	A	11: 121,560,743	N546K	probably damaging	Het
Tenm4	A	G	7: 96,888,827	D1832G	probably damaging	Het
Tfap2e	T	C	4: 126,734,646	I172M	probably benign	Het
Tnip2	A	G	5: 34,513,764	L45P	probably damaging	Het
Ttc3	T	C	16: 94,459,844	V1396A	probably benign	Het
Ube2o	A	T	11: 116,548,807	I179N	possibly damaging	Het
Usp17le	T	C	7: 104,769,234	I234V	probably damaging	Het
Zfp106	T	C	2: 120,534,781	T382A	probably benign	Het
Zfp607a	A	G	7: 27,879,319	K605E	possibly damaging	Het
Zmynd10	T	A	9: 107,550,586	L363H	possibly damaging	Het

Other mutations in Cntnap3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00433:Cntnap3	APN	13	64772731	missense	probably damaging	1.00
IGL00782:Cntnap3	APN	13	64745805	splice site	probably benign
IGL00976:Cntnap3	APN	13	64794352	missense	probably damaging	1.00
IGL01319:Cntnap3	APN	13	64787837	missense	probably damaging	1.00
IGL01610:Cntnap3	APN	13	64757301	missense	probably damaging	0.98
IGL01861:Cntnap3	APN	13	64799108	missense	probably damaging	1.00
IGL02127:Cntnap3	APN	13	64799064	splice site	probably benign
IGL02133:Cntnap3	APN	13	64751673	splice site	probably benign
IGL02251:Cntnap3	APN	13	64762036	missense	probably damaging	1.00
IGL02272:Cntnap3	APN	13	64757411	missense	probably damaging	1.00
IGL02370:Cntnap3	APN	13	64751751	missense	probably benign
IGL02456:Cntnap3	APN	13	64799058	splice site	probably benign
IGL02589:Cntnap3	APN	13	64792430	missense	probably benign	0.08
IGL02695:Cntnap3	APN	13	64772132	missense	probably benign	0.01
IGL02850:Cntnap3	APN	13	64757409	missense	probably damaging	1.00
IGL03038:Cntnap3	APN	13	64741025	missense	possibly damaging	0.50
IGL03188:Cntnap3	APN	13	64781745	missense	probably damaging	0.97
IGL03327:Cntnap3	APN	13	64887768	nonsense	probably null
PIT4480001:Cntnap3	UTSW	13	64757210	missense	probably damaging	1.00
R0309:Cntnap3	UTSW	13	64757436	splice site	probably benign
R0422:Cntnap3	UTSW	13	64757285	missense	probably damaging	0.96
R0463:Cntnap3	UTSW	13	64778876	missense	probably damaging	1.00
R0491:Cntnap3	UTSW	13	64762045	missense	probably benign	0.01
R0499:Cntnap3	UTSW	13	64858678	missense	probably benign	0.33
R0550:Cntnap3	UTSW	13	64762000	missense	possibly damaging	0.86
R0613:Cntnap3	UTSW	13	64758414	missense	probably damaging	1.00
R0666:Cntnap3	UTSW	13	64757397	missense	probably damaging	1.00
R0840:Cntnap3	UTSW	13	64787910	missense	possibly damaging	0.94
R1577:Cntnap3	UTSW	13	64758290	missense	probably damaging	1.00
R1716:Cntnap3	UTSW	13	64762002	missense	probably damaging	1.00
R1732:Cntnap3	UTSW	13	64740812	critical splice donor site	probably null
R1739:Cntnap3	UTSW	13	64740592	missense	probably benign	0.17
R1905:Cntnap3	UTSW	13	64903764	missense	probably benign	0.04
R1988:Cntnap3	UTSW	13	64758390	missense	probably damaging	1.00
R2086:Cntnap3	UTSW	13	64794262	missense	possibly damaging	0.76
R3732:Cntnap3	UTSW	13	64740999	missense	possibly damaging	0.73
R3808:Cntnap3	UTSW	13	64781804	missense	probably damaging	0.96
R3809:Cntnap3	UTSW	13	64781804	missense	probably damaging	0.96
R4384:Cntnap3	UTSW	13	64748460	missense	probably damaging	1.00
R4433:Cntnap3	UTSW	13	64778853	missense	possibly damaging	0.92
R4631:Cntnap3	UTSW	13	64778883	missense	probably benign	0.04
R4645:Cntnap3	UTSW	13	64778788	critical splice donor site	probably null
R4702:Cntnap3	UTSW	13	64778862	missense	probably benign	0.17
R4876:Cntnap3	UTSW	13	64787706	missense	probably benign	0.00
R4994:Cntnap3	UTSW	13	64761984	missense	possibly damaging	0.55
R5043:Cntnap3	UTSW	13	64794348	missense	probably damaging	1.00
R5214:Cntnap3	UTSW	13	64762010	missense	probably damaging	1.00
R5571:Cntnap3	UTSW	13	64903758	missense	probably damaging	0.98
R5587:Cntnap3	UTSW	13	64746738	missense	probably damaging	1.00
R5695:Cntnap3	UTSW	13	64787955	missense	probably damaging	0.99
R5834:Cntnap3	UTSW	13	64748577	missense	probably benign	0.07
R5892:Cntnap3	UTSW	13	64799180	missense	probably damaging	1.00
R5950:Cntnap3	UTSW	13	64787769	missense	probably damaging	1.00
R6526:Cntnap3	UTSW	13	64781888	missense	possibly damaging	0.96
R6954:Cntnap3	UTSW	13	64748559	missense	probably benign	0.00
R7138:Cntnap3	UTSW	13	64781725	critical splice donor site	probably null
R7355:Cntnap3	UTSW	13	64771962	missense	probably benign
R7425:Cntnap3	UTSW	13	64758252	missense	probably damaging	1.00
R7521:Cntnap3	UTSW	13	64772001	missense	probably benign	0.22
R7719:Cntnap3	UTSW	13	64772777	nonsense	probably null
R7810:Cntnap3	UTSW	13	64793308	missense	possibly damaging	0.73
R7871:Cntnap3	UTSW	13	64903773	missense	probably benign	0.00
R8259:Cntnap3	UTSW	13	64787867	missense	probably damaging	0.99
R8415:Cntnap3	UTSW	13	64738665	missense	probably benign	0.31
Z1176:Cntnap3	UTSW	13	64740872	frame shift	probably null
Z1176:Cntnap3	UTSW	13	64792388	missense	probably damaging	0.98
Z1177:Cntnap3	UTSW	13	64781892	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TGACAAAGCTTTCACACCTCAG -3'
(R):5'- CTGAGACTAATCTTGAAAGAGCAG -3'

Sequencing Primer
(F):5'- CCTGAACGTTAAAGGCTTGGTTACC -3'
(R):5'- GAAAGAGCAGTAATTGCTTCAT -3'

Posted On

2016-09-06