Incidental Mutation 'R5403:Dnah8'
ID 430140
Institutional Source Beutler Lab
Gene Symbol Dnah8
Ensembl Gene ENSMUSG00000033826
Gene Name dynein, axonemal, heavy chain 8
Synonyms Dnahc8, P1-Loop, Hst6.7b
MMRRC Submission 042974-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.423) question?
Stock # R5403 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 30624354-30875264 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 30748568 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Asparagine at position 2585 (D2585N)
Ref Sequence ENSEMBL: ENSMUSP00000127878 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170651]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000170651
AA Change: D2585N

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000127878
Gene: ENSMUSG00000033826
AA Change: D2585N

DomainStartEndE-ValueType
low complexity region 2 54 N/A INTRINSIC
Pfam:DHC_N1 379 936 8.4e-159 PFAM
low complexity region 1069 1080 N/A INTRINSIC
low complexity region 1224 1237 N/A INTRINSIC
Pfam:DHC_N2 1509 1917 1.6e-134 PFAM
AAA 2082 2226 1.38e-1 SMART
AAA 2363 2516 2.04e-1 SMART
AAA 2689 2837 8.15e-2 SMART
Pfam:AAA_8 3022 3294 4e-72 PFAM
Pfam:MT 3306 3656 3.6e-48 PFAM
Pfam:AAA_9 3676 3901 6.7e-85 PFAM
Pfam:Dynein_heavy 4039 4728 8.4e-250 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a heavy chain of an axonemal dynein involved in sperm and respiratory cilia motility. Axonemal dyneins generate force through hydrolysis of ATP and binding to microtubules. [provided by RefSeq, Jan 2012]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik G T 17: 56,876,221 (GRCm38) probably benign Het
Adamts6 A G 13: 104,352,815 (GRCm38) D392G possibly damaging Het
Adcy8 C T 15: 64,716,152 (GRCm38) V929I probably benign Het
Alkbh8 A G 9: 3,385,318 (GRCm38) K537E probably benign Het
Anp32a A T 9: 62,341,993 (GRCm38) I16F possibly damaging Het
Asb18 T C 1: 90,014,388 (GRCm38) T64A probably benign Het
Bpifb4 A T 2: 153,943,992 (GRCm38) I17F probably damaging Het
Brd7 G T 8: 88,357,541 (GRCm38) Q148K probably damaging Het
Brinp1 A G 4: 68,792,964 (GRCm38) W336R probably benign Het
Ccdc88b T A 19: 6,857,740 (GRCm38) T38S unknown Het
Cd46 C T 1: 195,062,411 (GRCm38) V340I possibly damaging Het
Cdr2 G A 7: 120,958,745 (GRCm38) Q186* probably null Het
Ces1e T G 8: 93,208,612 (GRCm38) D404A probably benign Het
Chd3 A T 11: 69,349,069 (GRCm38) probably null Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 (GRCm38) probably benign Het
Cntnap3 G A 13: 64,761,978 (GRCm38) T771I possibly damaging Het
Cops8 C T 1: 90,606,620 (GRCm38) probably benign Het
Csmd2 C T 4: 128,486,884 (GRCm38) R2078C probably benign Het
Ddx50 A G 10: 62,647,030 (GRCm38) S87P probably benign Het
Dlg2 A G 7: 92,431,002 (GRCm38) T598A probably damaging Het
Epha6 A T 16: 59,775,570 (GRCm38) D919E probably damaging Het
Fam109a A G 5: 121,852,731 (GRCm38) E52G possibly damaging Het
Fam196b A T 11: 34,403,058 (GRCm38) T367S probably benign Het
Fndc9 C T 11: 46,237,714 (GRCm38) S20L probably benign Het
Gpx6 A G 13: 21,317,643 (GRCm38) E145G probably damaging Het
Hc A G 2: 35,057,434 (GRCm38) Y23H probably damaging Het
Jmy G T 13: 93,441,396 (GRCm38) Q755K probably benign Het
Krtap4-7 A T 11: 99,643,714 (GRCm38) S108T unknown Het
Mgat5b T G 11: 116,948,657 (GRCm38) I333S probably benign Het
Mkl2 A G 16: 13,401,013 (GRCm38) T519A probably damaging Het
Naip6 G A 13: 100,300,077 (GRCm38) A646V probably benign Het
Olfr1416 A T 1: 92,480,297 (GRCm38) V108E possibly damaging Het
Olfr936 G T 9: 39,046,703 (GRCm38) P239T probably damaging Het
Opn4 T C 14: 34,592,937 (GRCm38) T460A probably benign Het
Otogl T A 10: 107,808,756 (GRCm38) M1210L probably benign Het
Phf24 A T 4: 42,933,831 (GRCm38) probably null Het
Ppargc1a G A 5: 51,462,825 (GRCm38) probably benign Het
Ptprd G A 4: 75,954,168 (GRCm38) R1355* probably null Het
Rad50 A G 11: 53,695,281 (GRCm38) probably null Het
Robo4 CGG CG 9: 37,411,490 (GRCm38) probably null Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 (GRCm38) probably benign Het
St5 A G 7: 109,556,905 (GRCm38) S213P probably damaging Het
Tbcd C A 11: 121,560,743 (GRCm38) N546K probably damaging Het
Tenm4 A G 7: 96,888,827 (GRCm38) D1832G probably damaging Het
Tfap2e T C 4: 126,734,646 (GRCm38) I172M probably benign Het
Tnip2 A G 5: 34,513,764 (GRCm38) L45P probably damaging Het
Ttc3 T C 16: 94,459,844 (GRCm38) V1396A probably benign Het
Ube2o A T 11: 116,548,807 (GRCm38) I179N possibly damaging Het
Usp17le T C 7: 104,769,234 (GRCm38) I234V probably damaging Het
Zfp106 T C 2: 120,534,781 (GRCm38) T382A probably benign Het
Zfp607a A G 7: 27,879,319 (GRCm38) K605E possibly damaging Het
Zmynd10 T A 9: 107,550,586 (GRCm38) L363H possibly damaging Het
Other mutations in Dnah8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:Dnah8 APN 17 30,677,176 (GRCm38) missense probably benign 0.06
IGL00508:Dnah8 APN 17 30,855,930 (GRCm38) missense probably damaging 1.00
IGL00547:Dnah8 APN 17 30,815,703 (GRCm38) nonsense probably null
IGL00551:Dnah8 APN 17 30,663,478 (GRCm38) nonsense probably null
IGL00732:Dnah8 APN 17 30,656,641 (GRCm38) missense probably damaging 1.00
IGL00775:Dnah8 APN 17 30,767,906 (GRCm38) nonsense probably null
IGL00840:Dnah8 APN 17 30,790,941 (GRCm38) missense probably damaging 1.00
IGL00845:Dnah8 APN 17 30,819,276 (GRCm38) critical splice donor site probably null
IGL00953:Dnah8 APN 17 30,706,457 (GRCm38) nonsense probably null
IGL00976:Dnah8 APN 17 30,851,710 (GRCm38) missense probably damaging 0.98
IGL01395:Dnah8 APN 17 30,636,005 (GRCm38) missense probably benign 0.06
IGL01467:Dnah8 APN 17 30,779,916 (GRCm38) missense probably damaging 1.00
IGL01469:Dnah8 APN 17 30,683,714 (GRCm38) splice site probably benign
IGL01515:Dnah8 APN 17 30,648,485 (GRCm38) missense probably benign
IGL01723:Dnah8 APN 17 30,708,471 (GRCm38) missense probably damaging 1.00
IGL01837:Dnah8 APN 17 30,751,591 (GRCm38) critical splice donor site probably null
IGL01921:Dnah8 APN 17 30,736,141 (GRCm38) missense probably benign
IGL01958:Dnah8 APN 17 30,855,895 (GRCm38) splice site probably benign
IGL01968:Dnah8 APN 17 30,656,598 (GRCm38) nonsense probably null
IGL02093:Dnah8 APN 17 30,717,880 (GRCm38) missense probably damaging 0.99
IGL02151:Dnah8 APN 17 30,648,417 (GRCm38) missense possibly damaging 0.50
IGL02182:Dnah8 APN 17 30,794,763 (GRCm38) missense possibly damaging 0.45
IGL02233:Dnah8 APN 17 30,706,513 (GRCm38) critical splice donor site probably null
IGL02236:Dnah8 APN 17 30,649,773 (GRCm38) nonsense probably null
IGL02259:Dnah8 APN 17 30,759,614 (GRCm38) missense probably benign
IGL02263:Dnah8 APN 17 30,729,165 (GRCm38) missense probably benign 0.00
IGL02303:Dnah8 APN 17 30,713,047 (GRCm38) missense probably benign 0.03
IGL02341:Dnah8 APN 17 30,747,257 (GRCm38) missense probably damaging 1.00
IGL02351:Dnah8 APN 17 30,767,811 (GRCm38) missense probably damaging 1.00
IGL02358:Dnah8 APN 17 30,767,811 (GRCm38) missense probably damaging 1.00
IGL02377:Dnah8 APN 17 30,794,796 (GRCm38) missense probably damaging 0.98
IGL02390:Dnah8 APN 17 30,830,845 (GRCm38) missense probably benign 0.01
IGL02392:Dnah8 APN 17 30,818,051 (GRCm38) splice site probably benign
IGL02414:Dnah8 APN 17 30,700,413 (GRCm38) missense probably benign
IGL02455:Dnah8 APN 17 30,672,334 (GRCm38) missense probably damaging 0.99
IGL02817:Dnah8 APN 17 30,668,295 (GRCm38) missense probably benign
IGL02831:Dnah8 APN 17 30,712,276 (GRCm38) missense probably benign 0.23
IGL02863:Dnah8 APN 17 30,769,697 (GRCm38) missense probably damaging 1.00
IGL02894:Dnah8 APN 17 30,721,110 (GRCm38) nonsense probably null
IGL02954:Dnah8 APN 17 30,704,835 (GRCm38) missense probably benign 0.30
IGL02964:Dnah8 APN 17 30,746,761 (GRCm38) missense probably damaging 1.00
IGL03080:Dnah8 APN 17 30,719,006 (GRCm38) missense probably benign 0.01
IGL03081:Dnah8 APN 17 30,686,373 (GRCm38) splice site probably benign
IGL03086:Dnah8 APN 17 30,742,780 (GRCm38) missense probably damaging 1.00
IGL03087:Dnah8 APN 17 30,784,144 (GRCm38) missense probably benign
IGL03176:Dnah8 APN 17 30,694,037 (GRCm38) missense probably benign
IGL03191:Dnah8 APN 17 30,726,830 (GRCm38) missense probably damaging 0.99
IGL03210:Dnah8 APN 17 30,815,665 (GRCm38) missense probably damaging 0.96
IGL03252:Dnah8 APN 17 30,673,920 (GRCm38) splice site probably null
IGL03255:Dnah8 APN 17 30,741,381 (GRCm38) missense probably damaging 1.00
IGL03288:Dnah8 APN 17 30,672,349 (GRCm38) missense probably benign
IGL03348:Dnah8 APN 17 30,746,986 (GRCm38) missense probably damaging 0.99
Alternator UTSW 17 30,765,635 (GRCm38) missense probably benign
armature UTSW 17 30,708,390 (GRCm38) missense probably benign 0.02
Brush UTSW 17 30,746,990 (GRCm38) missense probably damaging 1.00
Dynos UTSW 17 30,715,509 (GRCm38) missense possibly damaging 0.84
joule UTSW 17 30,713,098 (GRCm38) critical splice donor site probably null
solenoid UTSW 17 30,741,178 (GRCm38) missense probably damaging 1.00
FR4340:Dnah8 UTSW 17 30,635,463 (GRCm38) small deletion probably benign
FR4737:Dnah8 UTSW 17 30,635,477 (GRCm38) small deletion probably benign
FR4737:Dnah8 UTSW 17 30,635,465 (GRCm38) small deletion probably benign
I2288:Dnah8 UTSW 17 30,663,454 (GRCm38) missense probably benign
P0029:Dnah8 UTSW 17 30,765,720 (GRCm38) missense probably damaging 1.00
PIT4812001:Dnah8 UTSW 17 30,708,445 (GRCm38) missense probably benign 0.04
R0016:Dnah8 UTSW 17 30,663,316 (GRCm38) missense probably benign
R0035:Dnah8 UTSW 17 30,683,621 (GRCm38) splice site probably benign
R0035:Dnah8 UTSW 17 30,683,621 (GRCm38) splice site probably benign
R0062:Dnah8 UTSW 17 30,765,711 (GRCm38) missense probably damaging 1.00
R0062:Dnah8 UTSW 17 30,765,711 (GRCm38) missense probably damaging 1.00
R0087:Dnah8 UTSW 17 30,755,119 (GRCm38) missense probably damaging 1.00
R0090:Dnah8 UTSW 17 30,784,090 (GRCm38) missense probably benign 0.20
R0119:Dnah8 UTSW 17 30,715,509 (GRCm38) missense possibly damaging 0.84
R0164:Dnah8 UTSW 17 30,748,665 (GRCm38) missense probably benign
R0164:Dnah8 UTSW 17 30,748,665 (GRCm38) missense probably benign
R0184:Dnah8 UTSW 17 30,683,683 (GRCm38) missense probably benign 0.04
R0240:Dnah8 UTSW 17 30,765,679 (GRCm38) missense probably damaging 0.98
R0240:Dnah8 UTSW 17 30,765,679 (GRCm38) missense probably damaging 0.98
R0241:Dnah8 UTSW 17 30,765,679 (GRCm38) missense probably damaging 0.98
R0241:Dnah8 UTSW 17 30,765,679 (GRCm38) missense probably damaging 0.98
R0265:Dnah8 UTSW 17 30,690,271 (GRCm38) missense probably benign
R0268:Dnah8 UTSW 17 30,769,707 (GRCm38) missense probably damaging 1.00
R0282:Dnah8 UTSW 17 30,736,156 (GRCm38) missense probably damaging 1.00
R0299:Dnah8 UTSW 17 30,715,509 (GRCm38) missense possibly damaging 0.84
R0334:Dnah8 UTSW 17 30,871,351 (GRCm38) missense probably damaging 0.99
R0393:Dnah8 UTSW 17 30,708,390 (GRCm38) missense probably benign 0.02
R0423:Dnah8 UTSW 17 30,701,981 (GRCm38) missense probably benign
R0470:Dnah8 UTSW 17 30,708,540 (GRCm38) splice site probably benign
R0477:Dnah8 UTSW 17 30,755,080 (GRCm38) missense probably damaging 1.00
R0490:Dnah8 UTSW 17 30,700,419 (GRCm38) missense probably benign
R0499:Dnah8 UTSW 17 30,715,509 (GRCm38) missense possibly damaging 0.84
R0582:Dnah8 UTSW 17 30,718,961 (GRCm38) missense probably benign 0.01
R0601:Dnah8 UTSW 17 30,708,358 (GRCm38) missense probably benign 0.06
R0646:Dnah8 UTSW 17 30,684,173 (GRCm38) missense probably damaging 0.97
R0665:Dnah8 UTSW 17 30,736,155 (GRCm38) missense probably damaging 0.99
R0800:Dnah8 UTSW 17 30,704,662 (GRCm38) missense probably benign
R0843:Dnah8 UTSW 17 30,813,095 (GRCm38) missense probably damaging 1.00
R0940:Dnah8 UTSW 17 30,803,243 (GRCm38) missense probably damaging 1.00
R0964:Dnah8 UTSW 17 30,673,920 (GRCm38) splice site probably null
R1102:Dnah8 UTSW 17 30,854,764 (GRCm38) splice site probably null
R1137:Dnah8 UTSW 17 30,855,936 (GRCm38) missense probably damaging 1.00
R1342:Dnah8 UTSW 17 30,721,000 (GRCm38) missense probably damaging 0.99
R1375:Dnah8 UTSW 17 30,737,295 (GRCm38) missense probably damaging 1.00
R1377:Dnah8 UTSW 17 30,840,622 (GRCm38) nonsense probably null
R1464:Dnah8 UTSW 17 30,695,173 (GRCm38) missense possibly damaging 0.81
R1464:Dnah8 UTSW 17 30,695,173 (GRCm38) missense possibly damaging 0.81
R1470:Dnah8 UTSW 17 30,747,277 (GRCm38) nonsense probably null
R1470:Dnah8 UTSW 17 30,747,277 (GRCm38) nonsense probably null
R1497:Dnah8 UTSW 17 30,752,075 (GRCm38) missense probably damaging 1.00
R1513:Dnah8 UTSW 17 30,673,888 (GRCm38) missense probably benign
R1541:Dnah8 UTSW 17 30,747,247 (GRCm38) missense probably damaging 1.00
R1563:Dnah8 UTSW 17 30,635,664 (GRCm38) missense probably benign 0.07
R1634:Dnah8 UTSW 17 30,713,098 (GRCm38) critical splice donor site probably null
R1670:Dnah8 UTSW 17 30,725,124 (GRCm38) missense probably damaging 1.00
R1710:Dnah8 UTSW 17 30,854,940 (GRCm38) missense probably damaging 1.00
R1743:Dnah8 UTSW 17 30,769,651 (GRCm38) missense probably benign 0.28
R1761:Dnah8 UTSW 17 30,779,916 (GRCm38) missense probably damaging 1.00
R1785:Dnah8 UTSW 17 30,722,937 (GRCm38) missense probably damaging 0.98
R1804:Dnah8 UTSW 17 30,708,407 (GRCm38) missense probably benign 0.00
R1808:Dnah8 UTSW 17 30,684,186 (GRCm38) missense probably damaging 1.00
R1824:Dnah8 UTSW 17 30,731,180 (GRCm38) missense possibly damaging 0.67
R1836:Dnah8 UTSW 17 30,874,927 (GRCm38) missense possibly damaging 0.94
R1935:Dnah8 UTSW 17 30,635,505 (GRCm38) missense unknown
R1935:Dnah8 UTSW 17 30,726,896 (GRCm38) splice site probably benign
R1940:Dnah8 UTSW 17 30,731,207 (GRCm38) missense probably damaging 1.00
R1946:Dnah8 UTSW 17 30,712,385 (GRCm38) missense probably benign 0.00
R2025:Dnah8 UTSW 17 30,731,159 (GRCm38) missense probably damaging 0.99
R2038:Dnah8 UTSW 17 30,758,281 (GRCm38) missense probably damaging 1.00
R2042:Dnah8 UTSW 17 30,635,658 (GRCm38) missense probably benign 0.01
R2148:Dnah8 UTSW 17 30,737,258 (GRCm38) missense probably damaging 1.00
R2177:Dnah8 UTSW 17 30,653,393 (GRCm38) missense probably benign
R2180:Dnah8 UTSW 17 30,840,647 (GRCm38) missense probably benign 0.00
R2262:Dnah8 UTSW 17 30,673,835 (GRCm38) missense probably damaging 1.00
R2263:Dnah8 UTSW 17 30,673,835 (GRCm38) missense probably damaging 1.00
R2328:Dnah8 UTSW 17 30,794,744 (GRCm38) missense probably damaging 1.00
R2357:Dnah8 UTSW 17 30,771,872 (GRCm38) missense probably benign
R2357:Dnah8 UTSW 17 30,874,935 (GRCm38) missense probably benign 0.00
R2360:Dnah8 UTSW 17 30,677,204 (GRCm38) missense probably benign 0.22
R2496:Dnah8 UTSW 17 30,851,731 (GRCm38) missense probably damaging 1.00
R2497:Dnah8 UTSW 17 30,741,365 (GRCm38) nonsense probably null
R2509:Dnah8 UTSW 17 30,775,045 (GRCm38) missense probably benign 0.02
R3114:Dnah8 UTSW 17 30,833,568 (GRCm38) missense probably benign 0.04
R3708:Dnah8 UTSW 17 30,739,657 (GRCm38) missense probably damaging 0.98
R3720:Dnah8 UTSW 17 30,854,898 (GRCm38) missense probably damaging 1.00
R3722:Dnah8 UTSW 17 30,854,898 (GRCm38) missense probably damaging 1.00
R3727:Dnah8 UTSW 17 30,739,648 (GRCm38) nonsense probably null
R3747:Dnah8 UTSW 17 30,784,174 (GRCm38) nonsense probably null
R3748:Dnah8 UTSW 17 30,784,174 (GRCm38) nonsense probably null
R3749:Dnah8 UTSW 17 30,784,174 (GRCm38) nonsense probably null
R3787:Dnah8 UTSW 17 30,755,041 (GRCm38) missense probably damaging 1.00
R3790:Dnah8 UTSW 17 30,854,898 (GRCm38) missense probably damaging 1.00
R3804:Dnah8 UTSW 17 30,670,647 (GRCm38) missense probably benign 0.00
R3857:Dnah8 UTSW 17 30,663,422 (GRCm38) missense probably damaging 0.96
R3898:Dnah8 UTSW 17 30,854,898 (GRCm38) missense probably damaging 1.00
R3899:Dnah8 UTSW 17 30,854,898 (GRCm38) missense probably damaging 1.00
R3938:Dnah8 UTSW 17 30,854,937 (GRCm38) missense probably damaging 1.00
R3943:Dnah8 UTSW 17 30,694,065 (GRCm38) splice site probably benign
R4091:Dnah8 UTSW 17 30,769,839 (GRCm38) missense probably damaging 1.00
R4291:Dnah8 UTSW 17 30,748,559 (GRCm38) missense probably benign
R4326:Dnah8 UTSW 17 30,752,092 (GRCm38) missense probably benign 0.04
R4346:Dnah8 UTSW 17 30,725,098 (GRCm38) missense possibly damaging 0.92
R4429:Dnah8 UTSW 17 30,752,146 (GRCm38) missense probably damaging 1.00
R4457:Dnah8 UTSW 17 30,813,151 (GRCm38) missense probably benign
R4475:Dnah8 UTSW 17 30,656,985 (GRCm38) missense probably benign 0.12
R4565:Dnah8 UTSW 17 30,748,568 (GRCm38) missense probably benign 0.00
R4566:Dnah8 UTSW 17 30,748,568 (GRCm38) missense probably benign 0.00
R4568:Dnah8 UTSW 17 30,748,568 (GRCm38) missense probably benign 0.00
R4573:Dnah8 UTSW 17 30,700,406 (GRCm38) missense probably benign 0.00
R4580:Dnah8 UTSW 17 30,662,052 (GRCm38) missense probably benign 0.00
R4585:Dnah8 UTSW 17 30,751,567 (GRCm38) missense probably benign 0.01
R4611:Dnah8 UTSW 17 30,684,237 (GRCm38) missense probably damaging 1.00
R4720:Dnah8 UTSW 17 30,683,634 (GRCm38) missense probably benign 0.08
R4721:Dnah8 UTSW 17 30,725,166 (GRCm38) missense probably damaging 1.00
R4727:Dnah8 UTSW 17 30,851,747 (GRCm38) missense probably damaging 1.00
R4731:Dnah8 UTSW 17 30,775,061 (GRCm38) missense probably null 0.02
R4732:Dnah8 UTSW 17 30,775,061 (GRCm38) missense probably null 0.02
R4733:Dnah8 UTSW 17 30,775,061 (GRCm38) missense probably null 0.02
R4798:Dnah8 UTSW 17 30,748,568 (GRCm38) missense probably benign 0.00
R4814:Dnah8 UTSW 17 30,767,924 (GRCm38) missense probably damaging 1.00
R4892:Dnah8 UTSW 17 30,748,568 (GRCm38) missense probably benign 0.00
R4894:Dnah8 UTSW 17 30,748,568 (GRCm38) missense probably benign 0.00
R4900:Dnah8 UTSW 17 30,746,975 (GRCm38) missense probably damaging 1.00
R4901:Dnah8 UTSW 17 30,840,714 (GRCm38) critical splice donor site probably null
R4913:Dnah8 UTSW 17 30,819,139 (GRCm38) missense probably damaging 0.99
R4931:Dnah8 UTSW 17 30,748,568 (GRCm38) missense probably benign 0.00
R4932:Dnah8 UTSW 17 30,748,568 (GRCm38) missense probably benign 0.00
R4933:Dnah8 UTSW 17 30,748,568 (GRCm38) missense probably benign 0.00
R4942:Dnah8 UTSW 17 30,729,142 (GRCm38) missense probably benign
R4969:Dnah8 UTSW 17 30,723,014 (GRCm38) missense probably damaging 1.00
R4975:Dnah8 UTSW 17 30,656,985 (GRCm38) missense probably benign 0.12
R4977:Dnah8 UTSW 17 30,663,301 (GRCm38) missense probably benign 0.00
R5001:Dnah8 UTSW 17 30,787,185 (GRCm38) missense probably damaging 1.00
R5011:Dnah8 UTSW 17 30,748,568 (GRCm38) missense probably benign 0.00
R5013:Dnah8 UTSW 17 30,748,568 (GRCm38) missense probably benign 0.00
R5014:Dnah8 UTSW 17 30,748,568 (GRCm38) missense probably benign 0.00
R5024:Dnah8 UTSW 17 30,736,096 (GRCm38) missense probably damaging 1.00
R5075:Dnah8 UTSW 17 30,748,568 (GRCm38) missense probably benign 0.00
R5075:Dnah8 UTSW 17 30,800,531 (GRCm38) missense probably damaging 1.00
R5075:Dnah8 UTSW 17 30,739,757 (GRCm38) critical splice donor site probably null
R5112:Dnah8 UTSW 17 30,731,038 (GRCm38) missense probably benign 0.02
R5121:Dnah8 UTSW 17 30,810,353 (GRCm38) missense probably benign 0.14
R5138:Dnah8 UTSW 17 30,765,597 (GRCm38) missense probably damaging 0.99
R5151:Dnah8 UTSW 17 30,712,295 (GRCm38) missense probably benign 0.06
R5191:Dnah8 UTSW 17 30,746,765 (GRCm38) missense probably damaging 1.00
R5238:Dnah8 UTSW 17 30,790,917 (GRCm38) missense probably damaging 1.00
R5260:Dnah8 UTSW 17 30,700,419 (GRCm38) missense probably benign
R5358:Dnah8 UTSW 17 30,746,954 (GRCm38) missense probably damaging 1.00
R5404:Dnah8 UTSW 17 30,748,568 (GRCm38) missense probably benign 0.00
R5482:Dnah8 UTSW 17 30,800,547 (GRCm38) missense probably damaging 0.96
R5489:Dnah8 UTSW 17 30,790,956 (GRCm38) missense probably damaging 1.00
R5513:Dnah8 UTSW 17 30,752,916 (GRCm38) missense probably damaging 0.99
R5635:Dnah8 UTSW 17 30,706,386 (GRCm38) missense probably benign 0.00
R5640:Dnah8 UTSW 17 30,803,108 (GRCm38) missense probably damaging 1.00
R5649:Dnah8 UTSW 17 30,800,587 (GRCm38) missense probably benign 0.13
R5662:Dnah8 UTSW 17 30,737,333 (GRCm38) missense probably damaging 1.00
R5673:Dnah8 UTSW 17 30,803,261 (GRCm38) missense probably damaging 1.00
R5677:Dnah8 UTSW 17 30,748,568 (GRCm38) missense probably benign 0.00
R5699:Dnah8 UTSW 17 30,810,324 (GRCm38) missense probably benign 0.22
R5737:Dnah8 UTSW 17 30,748,568 (GRCm38) missense probably benign 0.00
R5738:Dnah8 UTSW 17 30,748,568 (GRCm38) missense probably benign 0.00
R5739:Dnah8 UTSW 17 30,719,007 (GRCm38) missense probably benign 0.00
R5766:Dnah8 UTSW 17 30,690,261 (GRCm38) missense probably benign 0.01
R5790:Dnah8 UTSW 17 30,875,004 (GRCm38) missense probably damaging 0.98
R5848:Dnah8 UTSW 17 30,728,191 (GRCm38) missense possibly damaging 0.69
R5854:Dnah8 UTSW 17 30,794,763 (GRCm38) missense possibly damaging 0.45
R5885:Dnah8 UTSW 17 30,794,717 (GRCm38) missense probably damaging 1.00
R5886:Dnah8 UTSW 17 30,794,717 (GRCm38) missense probably damaging 1.00
R5887:Dnah8 UTSW 17 30,794,717 (GRCm38) missense probably damaging 1.00
R5899:Dnah8 UTSW 17 30,656,685 (GRCm38) missense probably benign 0.32
R5979:Dnah8 UTSW 17 30,815,664 (GRCm38) nonsense probably null
R5986:Dnah8 UTSW 17 30,851,630 (GRCm38) missense possibly damaging 0.83
R5999:Dnah8 UTSW 17 30,663,305 (GRCm38) missense probably benign 0.32
R6042:Dnah8 UTSW 17 30,747,265 (GRCm38) missense probably damaging 1.00
R6175:Dnah8 UTSW 17 30,748,568 (GRCm38) missense probably benign 0.00
R6181:Dnah8 UTSW 17 30,748,568 (GRCm38) missense probably benign 0.00
R6237:Dnah8 UTSW 17 30,747,854 (GRCm38) nonsense probably null
R6239:Dnah8 UTSW 17 30,810,359 (GRCm38) missense probably damaging 0.99
R6337:Dnah8 UTSW 17 30,748,568 (GRCm38) missense probably benign 0.00
R6365:Dnah8 UTSW 17 30,748,568 (GRCm38) missense probably benign 0.00
R6416:Dnah8 UTSW 17 30,765,635 (GRCm38) missense probably benign
R6443:Dnah8 UTSW 17 30,771,885 (GRCm38) missense probably benign 0.10
R6478:Dnah8 UTSW 17 30,748,568 (GRCm38) missense probably benign 0.00
R6479:Dnah8 UTSW 17 30,748,568 (GRCm38) missense probably benign 0.00
R6480:Dnah8 UTSW 17 30,748,568 (GRCm38) missense probably benign 0.00
R6481:Dnah8 UTSW 17 30,748,568 (GRCm38) missense probably benign 0.00
R6533:Dnah8 UTSW 17 30,746,990 (GRCm38) missense probably damaging 1.00
R6606:Dnah8 UTSW 17 30,748,568 (GRCm38) missense probably benign 0.00
R6608:Dnah8 UTSW 17 30,748,568 (GRCm38) missense probably benign 0.00
R6610:Dnah8 UTSW 17 30,748,568 (GRCm38) missense probably benign 0.00
R6675:Dnah8 UTSW 17 30,748,568 (GRCm38) missense probably benign 0.00
R6723:Dnah8 UTSW 17 30,748,568 (GRCm38) missense probably benign 0.00
R6724:Dnah8 UTSW 17 30,748,568 (GRCm38) missense probably benign 0.00
R6754:Dnah8 UTSW 17 30,748,568 (GRCm38) missense probably benign 0.00
R6755:Dnah8 UTSW 17 30,748,568 (GRCm38) missense probably benign 0.00
R6759:Dnah8 UTSW 17 30,663,292 (GRCm38) splice site probably null
R6765:Dnah8 UTSW 17 30,748,568 (GRCm38) missense probably benign 0.00
R6766:Dnah8 UTSW 17 30,748,568 (GRCm38) missense probably benign 0.00
R6778:Dnah8 UTSW 17 30,635,666 (GRCm38) missense probably benign 0.00
R6781:Dnah8 UTSW 17 30,765,724 (GRCm38) frame shift probably null
R6788:Dnah8 UTSW 17 30,648,465 (GRCm38) missense probably benign 0.14
R6814:Dnah8 UTSW 17 30,762,679 (GRCm38) missense probably damaging 1.00
R6825:Dnah8 UTSW 17 30,741,173 (GRCm38) missense probably damaging 1.00
R6838:Dnah8 UTSW 17 30,710,551 (GRCm38) missense probably damaging 1.00
R6872:Dnah8 UTSW 17 30,762,679 (GRCm38) missense probably damaging 1.00
R6877:Dnah8 UTSW 17 30,746,959 (GRCm38) missense probably damaging 1.00
R6944:Dnah8 UTSW 17 30,794,659 (GRCm38) missense probably benign 0.09
R6982:Dnah8 UTSW 17 30,767,925 (GRCm38) missense probably benign 0.03
R6984:Dnah8 UTSW 17 30,739,738 (GRCm38) missense probably damaging 1.00
R6987:Dnah8 UTSW 17 30,662,091 (GRCm38) missense possibly damaging 0.95
R6988:Dnah8 UTSW 17 30,643,275 (GRCm38) missense probably damaging 1.00
R7099:Dnah8 UTSW 17 30,704,724 (GRCm38) missense possibly damaging 0.93
R7106:Dnah8 UTSW 17 30,741,178 (GRCm38) missense probably damaging 1.00
R7112:Dnah8 UTSW 17 30,871,392 (GRCm38) missense possibly damaging 0.79
R7146:Dnah8 UTSW 17 30,769,644 (GRCm38) missense possibly damaging 0.90
R7146:Dnah8 UTSW 17 30,644,617 (GRCm38) missense probably benign 0.01
R7309:Dnah8 UTSW 17 30,875,014 (GRCm38) missense probably damaging 1.00
R7324:Dnah8 UTSW 17 30,784,125 (GRCm38) missense probably benign 0.01
R7373:Dnah8 UTSW 17 30,767,965 (GRCm38) critical splice donor site probably null
R7423:Dnah8 UTSW 17 30,704,769 (GRCm38) missense possibly damaging 0.86
R7430:Dnah8 UTSW 17 30,706,389 (GRCm38) missense probably damaging 0.98
R7450:Dnah8 UTSW 17 30,787,191 (GRCm38) missense probably damaging 0.99
R7580:Dnah8 UTSW 17 30,775,103 (GRCm38) missense probably damaging 0.98
R7604:Dnah8 UTSW 17 30,813,095 (GRCm38) missense probably damaging 1.00
R7635:Dnah8 UTSW 17 30,785,107 (GRCm38) missense probably damaging 1.00
R7646:Dnah8 UTSW 17 30,649,677 (GRCm38) missense probably benign 0.00
R7685:Dnah8 UTSW 17 30,657,973 (GRCm38) missense probably damaging 1.00
R7793:Dnah8 UTSW 17 30,855,944 (GRCm38) missense probably benign 0.20
R7827:Dnah8 UTSW 17 30,760,867 (GRCm38) frame shift probably null
R7866:Dnah8 UTSW 17 30,874,927 (GRCm38) missense possibly damaging 0.94
R7877:Dnah8 UTSW 17 30,663,374 (GRCm38) missense probably benign
R7891:Dnah8 UTSW 17 30,712,289 (GRCm38) missense probably benign 0.09
R7977:Dnah8 UTSW 17 30,744,524 (GRCm38) missense probably damaging 1.00
R7987:Dnah8 UTSW 17 30,744,524 (GRCm38) missense probably damaging 1.00
R8025:Dnah8 UTSW 17 30,741,337 (GRCm38) nonsense probably null
R8076:Dnah8 UTSW 17 30,784,153 (GRCm38) missense possibly damaging 0.94
R8170:Dnah8 UTSW 17 30,673,823 (GRCm38) missense probably damaging 1.00
R8199:Dnah8 UTSW 17 30,871,419 (GRCm38) missense probably benign 0.06
R8253:Dnah8 UTSW 17 30,760,867 (GRCm38) frame shift probably null
R8270:Dnah8 UTSW 17 30,840,713 (GRCm38) missense probably damaging 1.00
R8291:Dnah8 UTSW 17 30,765,727 (GRCm38) missense probably damaging 1.00
R8334:Dnah8 UTSW 17 30,769,831 (GRCm38) missense probably benign 0.12
R8348:Dnah8 UTSW 17 30,673,840 (GRCm38) missense probably benign
R8348:Dnah8 UTSW 17 30,736,147 (GRCm38) missense probably damaging 0.96
R8354:Dnah8 UTSW 17 30,643,260 (GRCm38) missense probably benign 0.17
R8355:Dnah8 UTSW 17 30,695,178 (GRCm38) missense possibly damaging 0.89
R8439:Dnah8 UTSW 17 30,760,867 (GRCm38) frame shift probably null
R8448:Dnah8 UTSW 17 30,673,840 (GRCm38) missense probably benign
R8459:Dnah8 UTSW 17 30,725,247 (GRCm38) critical splice donor site probably null
R8462:Dnah8 UTSW 17 30,656,629 (GRCm38) missense probably damaging 1.00
R8506:Dnah8 UTSW 17 30,721,134 (GRCm38) missense probably benign
R8524:Dnah8 UTSW 17 30,715,498 (GRCm38) missense possibly damaging 0.95
R8555:Dnah8 UTSW 17 30,721,110 (GRCm38) nonsense probably null
R8698:Dnah8 UTSW 17 30,875,035 (GRCm38) missense probably damaging 1.00
R8719:Dnah8 UTSW 17 30,741,315 (GRCm38) missense probably damaging 0.97
R8778:Dnah8 UTSW 17 30,760,867 (GRCm38) frame shift probably null
R8781:Dnah8 UTSW 17 30,725,104 (GRCm38) missense probably damaging 1.00
R8821:Dnah8 UTSW 17 30,794,738 (GRCm38) missense probably damaging 1.00
R8864:Dnah8 UTSW 17 30,762,642 (GRCm38) missense possibly damaging 0.95
R8885:Dnah8 UTSW 17 30,708,312 (GRCm38) missense possibly damaging 0.83
R8983:Dnah8 UTSW 17 30,851,654 (GRCm38) missense probably damaging 0.98
R8994:Dnah8 UTSW 17 30,790,833 (GRCm38) missense probably benign 0.05
R9031:Dnah8 UTSW 17 30,737,427 (GRCm38) missense probably damaging 1.00
R9068:Dnah8 UTSW 17 30,756,755 (GRCm38) missense possibly damaging 0.63
R9225:Dnah8 UTSW 17 30,635,673 (GRCm38) missense probably benign 0.01
R9280:Dnah8 UTSW 17 30,785,097 (GRCm38) missense possibly damaging 0.52
R9291:Dnah8 UTSW 17 30,725,125 (GRCm38) missense probably damaging 1.00
R9314:Dnah8 UTSW 17 30,771,883 (GRCm38) missense probably benign
R9347:Dnah8 UTSW 17 30,708,359 (GRCm38) missense probably benign 0.00
R9393:Dnah8 UTSW 17 30,653,387 (GRCm38) missense possibly damaging 0.53
R9415:Dnah8 UTSW 17 30,810,323 (GRCm38) missense probably benign 0.02
R9458:Dnah8 UTSW 17 30,830,803 (GRCm38) missense probably damaging 1.00
R9465:Dnah8 UTSW 17 30,760,867 (GRCm38) frame shift probably null
R9518:Dnah8 UTSW 17 30,760,867 (GRCm38) frame shift probably null
R9524:Dnah8 UTSW 17 30,760,867 (GRCm38) frame shift probably null
R9564:Dnah8 UTSW 17 30,713,047 (GRCm38) missense probably benign 0.07
R9587:Dnah8 UTSW 17 30,760,867 (GRCm38) frame shift probably null
R9599:Dnah8 UTSW 17 30,760,867 (GRCm38) frame shift probably null
R9641:Dnah8 UTSW 17 30,713,055 (GRCm38) missense probably benign 0.13
R9674:Dnah8 UTSW 17 30,779,138 (GRCm38) missense possibly damaging 0.84
R9679:Dnah8 UTSW 17 30,818,141 (GRCm38) missense probably benign
R9789:Dnah8 UTSW 17 30,761,130 (GRCm38) critical splice donor site probably null
RF027:Dnah8 UTSW 17 30,635,476 (GRCm38) frame shift probably null
X0001:Dnah8 UTSW 17 30,748,680 (GRCm38) missense probably damaging 1.00
X0013:Dnah8 UTSW 17 30,819,186 (GRCm38) missense possibly damaging 0.71
Z1176:Dnah8 UTSW 17 30,648,540 (GRCm38) missense probably benign
Z1177:Dnah8 UTSW 17 30,713,095 (GRCm38) missense probably null 1.00
Z1177:Dnah8 UTSW 17 30,694,033 (GRCm38) missense probably benign
Predicted Primers PCR Primer
(F):5'- ACACTCATCAGGCTATGTCTTG -3'
(R):5'- TACTTAGCCGCACTTACCGTAG -3'

Sequencing Primer
(F):5'- ATTTCTGTTTTCTTTTCTCTTCCCC -3'
(R):5'- CTCATACATAGTCTGCTGGG -3'
Posted On 2016-09-06