Incidental Mutation 'R4846:Pus1'
ID 430143
Institutional Source Beutler Lab
Gene Symbol Pus1
Ensembl Gene ENSMUSG00000029507
Gene Name pseudouridine synthase 1
Synonyms A730013B20Rik, mPus1p, MPUS1
MMRRC Submission 042459-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.287) question?
Stock # R4846 (G1)
Quality Score 50
Status Validated
Chromosome 5
Chromosomal Location 110921533-110928523 bp(-) (GRCm39)
Type of Mutation intron
DNA Base Change (assembly) T to C at 110927796 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000130814 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031481] [ENSMUST00000031483] [ENSMUST00000031490] [ENSMUST00000086643] [ENSMUST00000112426] [ENSMUST00000136483] [ENSMUST00000170468] [ENSMUST00000149208]
AlphaFold Q9WU56
Predicted Effect probably benign
Transcript: ENSMUST00000031481
SMART Domains Protein: ENSMUSP00000031481
Gene: ENSMUSG00000029507

DomainStartEndE-ValueType
Pfam:PseudoU_synth_1 54 161 4.7e-13 PFAM
Pfam:PseudoU_synth_1 201 307 2.9e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000031483
SMART Domains Protein: ENSMUSP00000031483
Gene: ENSMUSG00000029507

DomainStartEndE-ValueType
Pfam:PseudoU_synth_1 84 191 1.3e-11 PFAM
Pfam:PseudoU_synth_1 231 337 8.1e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000031490
SMART Domains Protein: ENSMUSP00000031490
Gene: ENSMUSG00000029512

DomainStartEndE-ValueType
S_TKc 16 278 3.6e-98 SMART
low complexity region 287 318 N/A INTRINSIC
low complexity region 340 356 N/A INTRINSIC
low complexity region 400 423 N/A INTRINSIC
Blast:S_TKc 459 837 1e-131 BLAST
Pfam:DUF3543 838 1048 1.8e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000086643
SMART Domains Protein: ENSMUSP00000083844
Gene: ENSMUSG00000029507

DomainStartEndE-ValueType
Pfam:PseudoU_synth_1 84 208 1.2e-7 PFAM
Pfam:PseudoU_synth_1 249 355 8.5e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112426
SMART Domains Protein: ENSMUSP00000108045
Gene: ENSMUSG00000029507

DomainStartEndE-ValueType
SCOP:d1dj0a1 48 116 1e-12 SMART
Pfam:PseudoU_synth_1 155 261 5.6e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132267
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181141
Predicted Effect probably benign
Transcript: ENSMUST00000136483
SMART Domains Protein: ENSMUSP00000115143
Gene: ENSMUSG00000029507

DomainStartEndE-ValueType
Pfam:PseudoU_synth_1 54 147 2e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170468
SMART Domains Protein: ENSMUSP00000130814
Gene: ENSMUSG00000029507

DomainStartEndE-ValueType
Pfam:PseudoU_synth_1 54 161 4.7e-13 PFAM
Pfam:PseudoU_synth_1 201 307 2.9e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149208
SMART Domains Protein: ENSMUSP00000115468
Gene: ENSMUSG00000029507

DomainStartEndE-ValueType
PDB:4J37|A 37 162 3e-57 PDB
SCOP:d1dj0a1 48 162 3e-17 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a pseudouridine synthase that converts uridine to pseudouridine once it has been incorporated into an RNA molecule. The encoded enzyme may play an essential role in tRNA function and in stabilizing the secondary and tertiary structure of many RNAs. A mutation in this gene has been linked to mitochondrial myopathy and sideroblastic anemia. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit slow postnatal weight gain, impaired exercise endurance, and alterations in muscle metabolism related to mitochondrial content and oxidative capacity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930012K11Rik T A 14: 70,393,392 (GRCm39) H299L probably damaging Het
Abcb4 C T 5: 8,985,180 (GRCm39) A687V probably benign Het
Abtb3 A G 10: 85,465,130 (GRCm39) T657A probably damaging Het
Adam20 A G 8: 41,248,048 (GRCm39) T53A probably benign Het
Afg1l G A 10: 42,330,490 (GRCm39) T59I probably benign Het
AI837181 A G 19: 5,476,329 (GRCm39) Q164R probably benign Het
Anapc15 T A 7: 101,546,974 (GRCm39) I12N probably benign Het
Ankrd55 A C 13: 112,499,988 (GRCm39) E278D probably benign Het
Axin2 A G 11: 108,833,125 (GRCm39) T437A probably benign Het
BC051665 T C 13: 60,931,895 (GRCm39) D168G probably damaging Het
Cd200 C T 16: 45,212,664 (GRCm39) R261H probably benign Het
Clk1 G A 1: 58,460,261 (GRCm39) S123L probably benign Het
Csrnp2 A T 15: 100,382,571 (GRCm39) D156E probably damaging Het
Ctss C T 3: 95,452,695 (GRCm39) Q159* probably null Het
Dennd2b C A 7: 109,156,043 (GRCm39) E236* probably null Het
Dip2a A G 10: 76,157,327 (GRCm39) S93P probably damaging Het
Dnase1l1 C T X: 73,320,644 (GRCm39) probably null Het
Dync1h1 C A 12: 110,624,560 (GRCm39) T3700N probably damaging Het
Ephb6 G A 6: 41,593,743 (GRCm39) R542Q probably benign Het
Fmo3 T C 1: 162,781,880 (GRCm39) D491G possibly damaging Het
Galnt14 A T 17: 73,843,888 (GRCm39) M140K probably benign Het
Ghsr T C 3: 27,425,986 (GRCm39) V14A probably benign Het
Gm17546 C A 15: 95,727,843 (GRCm39) probably benign Het
Gprc5c G T 11: 114,755,093 (GRCm39) V257L possibly damaging Het
Hc A G 2: 34,909,682 (GRCm39) V866A probably benign Het
Hoxb6 G A 11: 96,190,348 (GRCm39) G116R probably damaging Het
Hykk A G 9: 54,827,890 (GRCm39) Y43C probably damaging Het
Jade2 T C 11: 51,711,975 (GRCm39) T495A probably benign Het
Kansl1 A T 11: 104,233,798 (GRCm39) V755E possibly damaging Het
Lrp2 T A 2: 69,309,457 (GRCm39) D2814V probably damaging Het
Mbd5 T A 2: 49,147,009 (GRCm39) N406K probably damaging Het
Met A T 6: 17,491,928 (GRCm39) D230V probably damaging Het
Mrgprx2 A T 7: 48,132,584 (GRCm39) V78D probably damaging Het
Mrpl20 A G 4: 155,892,993 (GRCm39) T112A possibly damaging Het
Nek11 T A 9: 105,040,362 (GRCm39) E566D probably damaging Het
Nostrin T C 2: 69,005,923 (GRCm39) S235P probably damaging Het
Npas4 C A 19: 5,036,805 (GRCm39) S453I probably benign Het
Pnkp C T 7: 44,511,827 (GRCm39) S113L probably damaging Het
Psg18 A T 7: 18,084,711 (GRCm39) Y128* probably null Het
Ptges3l A T 11: 101,310,010 (GRCm39) probably benign Het
Raf1 T A 6: 115,621,544 (GRCm39) S12C possibly damaging Het
Rps6-ps2 T G 8: 89,533,206 (GRCm39) noncoding transcript Het
Slc5a4b A G 10: 75,898,073 (GRCm39) L547P probably damaging Het
Socs3 A G 11: 117,858,654 (GRCm39) S135P probably benign Het
Spata31d1e T C 13: 59,890,047 (GRCm39) D591G probably benign Het
Stra6l G A 4: 45,873,682 (GRCm39) V281M possibly damaging Het
Suco G A 1: 161,661,977 (GRCm39) T818I possibly damaging Het
Syde1 A T 10: 78,424,731 (GRCm39) V367D probably damaging Het
Tet3 A T 6: 83,353,865 (GRCm39) L932* probably null Het
Trpm7 G A 2: 126,655,105 (GRCm39) L1278F possibly damaging Het
Vmn1r168 A T 7: 23,240,490 (GRCm39) T116S probably damaging Het
Wfdc6b A G 2: 164,459,214 (GRCm39) Q92R possibly damaging Het
Other mutations in Pus1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0145:Pus1 UTSW 5 110,922,720 (GRCm39) missense probably benign 0.09
R0242:Pus1 UTSW 5 110,927,664 (GRCm39) missense probably benign 0.02
R0242:Pus1 UTSW 5 110,927,664 (GRCm39) missense probably benign 0.02
R0486:Pus1 UTSW 5 110,927,596 (GRCm39) missense probably damaging 1.00
R1922:Pus1 UTSW 5 110,925,505 (GRCm39) missense probably damaging 1.00
R2305:Pus1 UTSW 5 110,922,826 (GRCm39) missense probably benign 0.08
R4528:Pus1 UTSW 5 110,922,596 (GRCm39) missense probably damaging 1.00
R4609:Pus1 UTSW 5 110,928,184 (GRCm39) start codon destroyed probably null 0.06
R5720:Pus1 UTSW 5 110,925,584 (GRCm39) missense probably damaging 1.00
R6207:Pus1 UTSW 5 110,925,580 (GRCm39) missense probably benign 0.12
R7123:Pus1 UTSW 5 110,921,798 (GRCm39) makesense probably null
R7449:Pus1 UTSW 5 110,922,452 (GRCm39) missense probably damaging 1.00
R7827:Pus1 UTSW 5 110,927,582 (GRCm39) missense probably damaging 1.00
R8976:Pus1 UTSW 5 110,922,789 (GRCm39) missense possibly damaging 0.65
RF016:Pus1 UTSW 5 110,924,424 (GRCm39) missense not run
Predicted Primers PCR Primer
(F):5'- GCTCTGAGTAGCATCAGGGAAC -3'
(R):5'- GTGTCCAGTTCAAACTCCGC -3'

Sequencing Primer
(F):5'- GGCCATGAGCAGCACAATTTTTC -3'
(R):5'- GTTCAAACTCCGCCCGAG -3'
Posted On 2016-09-07