Incidental Mutation 'R4846:Pus1'
ID430143
Institutional Source Beutler Lab
Gene Symbol Pus1
Ensembl Gene ENSMUSG00000029507
Gene Namepseudouridine synthase 1
SynonymsMPUS1, A730013B20Rik, mPus1p
MMRRC Submission 042459-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.480) question?
Stock #R4846 (G1)
Quality Score50
Status Validated
Chromosome5
Chromosomal Location110773667-110780659 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 110779930 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000130814 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031481] [ENSMUST00000031483] [ENSMUST00000031490] [ENSMUST00000086643] [ENSMUST00000112426] [ENSMUST00000136483] [ENSMUST00000149208] [ENSMUST00000170468]
Predicted Effect probably benign
Transcript: ENSMUST00000031481
SMART Domains Protein: ENSMUSP00000031481
Gene: ENSMUSG00000029507

DomainStartEndE-ValueType
Pfam:PseudoU_synth_1 54 161 4.7e-13 PFAM
Pfam:PseudoU_synth_1 201 307 2.9e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000031483
SMART Domains Protein: ENSMUSP00000031483
Gene: ENSMUSG00000029507

DomainStartEndE-ValueType
Pfam:PseudoU_synth_1 84 191 1.3e-11 PFAM
Pfam:PseudoU_synth_1 231 337 8.1e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000031490
SMART Domains Protein: ENSMUSP00000031490
Gene: ENSMUSG00000029512

DomainStartEndE-ValueType
S_TKc 16 278 3.6e-98 SMART
low complexity region 287 318 N/A INTRINSIC
low complexity region 340 356 N/A INTRINSIC
low complexity region 400 423 N/A INTRINSIC
Blast:S_TKc 459 837 1e-131 BLAST
Pfam:DUF3543 838 1048 1.8e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000086643
SMART Domains Protein: ENSMUSP00000083844
Gene: ENSMUSG00000029507

DomainStartEndE-ValueType
Pfam:PseudoU_synth_1 84 208 1.2e-7 PFAM
Pfam:PseudoU_synth_1 249 355 8.5e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112426
SMART Domains Protein: ENSMUSP00000108045
Gene: ENSMUSG00000029507

DomainStartEndE-ValueType
SCOP:d1dj0a1 48 116 1e-12 SMART
Pfam:PseudoU_synth_1 155 261 5.6e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132267
Predicted Effect probably benign
Transcript: ENSMUST00000136483
SMART Domains Protein: ENSMUSP00000115143
Gene: ENSMUSG00000029507

DomainStartEndE-ValueType
Pfam:PseudoU_synth_1 54 147 2e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149208
SMART Domains Protein: ENSMUSP00000115468
Gene: ENSMUSG00000029507

DomainStartEndE-ValueType
PDB:4J37|A 37 162 3e-57 PDB
SCOP:d1dj0a1 48 162 3e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000170468
SMART Domains Protein: ENSMUSP00000130814
Gene: ENSMUSG00000029507

DomainStartEndE-ValueType
Pfam:PseudoU_synth_1 54 161 4.7e-13 PFAM
Pfam:PseudoU_synth_1 201 307 2.9e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181141
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a pseudouridine synthase that converts uridine to pseudouridine once it has been incorporated into an RNA molecule. The encoded enzyme may play an essential role in tRNA function and in stabilizing the secondary and tertiary structure of many RNAs. A mutation in this gene has been linked to mitochondrial myopathy and sideroblastic anemia. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit slow postnatal weight gain, impaired exercise endurance, and alterations in muscle metabolism related to mitochondrial content and oxidative capacity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,742,233 D591G probably benign Het
9930012K11Rik T A 14: 70,155,943 H299L probably damaging Het
Abcb4 C T 5: 8,935,180 A687V probably benign Het
Adam20 A G 8: 40,795,011 T53A probably benign Het
Afg1l G A 10: 42,454,494 T59I probably benign Het
AI837181 A G 19: 5,426,301 Q164R probably benign Het
Anapc15 T A 7: 101,897,767 I12N probably benign Het
Ankrd55 A C 13: 112,363,454 E278D probably benign Het
Axin2 A G 11: 108,942,299 T437A probably benign Het
BC051665 T C 13: 60,784,081 D168G probably damaging Het
Btbd11 A G 10: 85,629,266 T657A probably damaging Het
Cd200 C T 16: 45,392,301 R261H probably benign Het
Clk1 G A 1: 58,421,102 S123L probably benign Het
Csrnp2 A T 15: 100,484,690 D156E probably damaging Het
Ctss C T 3: 95,545,384 Q159* probably null Het
Dip2a A G 10: 76,321,493 S93P probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Ephb6 G A 6: 41,616,809 R542Q probably benign Het
Fmo3 T C 1: 162,954,311 D491G possibly damaging Het
Galnt14 A T 17: 73,536,893 M140K probably benign Het
Ghsr T C 3: 27,371,837 V14A probably benign Het
Gm17546 C A 15: 95,829,962 probably benign Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Hc A G 2: 35,019,670 V866A probably benign Het
Hoxb6 G A 11: 96,299,522 G116R probably damaging Het
Hykk A G 9: 54,920,606 Y43C probably damaging Het
Jade2 T C 11: 51,821,148 T495A probably benign Het
Kansl1 A T 11: 104,342,972 V755E possibly damaging Het
Lrp2 T A 2: 69,479,113 D2814V probably damaging Het
Mbd5 T A 2: 49,256,997 N406K probably damaging Het
Met A T 6: 17,491,929 D230V probably damaging Het
Mrgprx2 A T 7: 48,482,836 V78D probably damaging Het
Mrpl20 A G 4: 155,808,536 T112A possibly damaging Het
Nek11 T A 9: 105,163,163 E566D probably damaging Het
Nostrin T C 2: 69,175,579 S235P probably damaging Het
Npas4 C A 19: 4,986,777 S453I probably benign Het
Pnkp C T 7: 44,862,403 S113L probably damaging Het
Psg18 A T 7: 18,350,786 Y128* probably null Het
Ptges3l A T 11: 101,419,184 probably benign Het
Raf1 T A 6: 115,644,583 S12C possibly damaging Het
Rps6-ps2 T G 8: 88,806,578 noncoding transcript Het
Slc5a4b A G 10: 76,062,239 L547P probably damaging Het
Socs3 A G 11: 117,967,828 S135P probably benign Het
St5 C A 7: 109,556,836 E236* probably null Het
Stra6l G A 4: 45,873,682 V281M possibly damaging Het
Suco G A 1: 161,834,408 T818I possibly damaging Het
Syde1 A T 10: 78,588,897 V367D probably damaging Het
Tet3 A T 6: 83,376,883 L932* probably null Het
Trpm7 G A 2: 126,813,185 L1278F possibly damaging Het
Vmn1r168 A T 7: 23,541,065 T116S probably damaging Het
Wfdc6b A G 2: 164,617,294 Q92R possibly damaging Het
Other mutations in Pus1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0145:Pus1 UTSW 5 110774854 missense probably benign 0.09
R0242:Pus1 UTSW 5 110779798 missense probably benign 0.02
R0242:Pus1 UTSW 5 110779798 missense probably benign 0.02
R0486:Pus1 UTSW 5 110779730 missense probably damaging 1.00
R1922:Pus1 UTSW 5 110777639 missense probably damaging 1.00
R2305:Pus1 UTSW 5 110774960 missense probably benign 0.08
R4528:Pus1 UTSW 5 110774730 missense probably damaging 1.00
R4609:Pus1 UTSW 5 110780318 start codon destroyed probably null 0.06
R5720:Pus1 UTSW 5 110777718 missense probably damaging 1.00
R6207:Pus1 UTSW 5 110777714 missense probably benign 0.12
R7123:Pus1 UTSW 5 110773932 makesense probably null
R7449:Pus1 UTSW 5 110774586 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTCTGAGTAGCATCAGGGAAC -3'
(R):5'- GTGTCCAGTTCAAACTCCGC -3'

Sequencing Primer
(F):5'- GGCCATGAGCAGCACAATTTTTC -3'
(R):5'- GTTCAAACTCCGCCCGAG -3'
Posted On2016-09-07