Incidental Mutation 'R4846:Ptges3l'
ID 430144
Institutional Source Beutler Lab
Gene Symbol Ptges3l
Ensembl Gene ENSMUSG00000097487
Gene Name prostaglandin E synthase 3 like
Synonyms 1110069E20Rik, 1700113I22Rik
MMRRC Submission 042459-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.241) question?
Stock # R4846 (G1)
Quality Score 85
Status Validated
Chromosome 11
Chromosomal Location 101309634-101316154 bp(-) (GRCm39)
Type of Mutation unclassified
DNA Base Change (assembly) A to T at 101310010 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000070395] [ENSMUST00000093933] [ENSMUST00000103102] [ENSMUST00000107252] [ENSMUST00000107257] [ENSMUST00000107259]
AlphaFold Q9D9A7
Predicted Effect probably benign
Transcript: ENSMUST00000070395
SMART Domains Protein: ENSMUSP00000067912
Gene: ENSMUSG00000075528

DomainStartEndE-ValueType
Pfam:tRNA-synt_2c 8 101 1.5e-8 PFAM
tRNA_SAD 196 239 1.43e-6 SMART
low complexity region 276 293 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000093933
SMART Domains Protein: ENSMUSP00000091465
Gene: ENSMUSG00000097487

DomainStartEndE-ValueType
Pfam:CS 6 80 8.7e-9 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000103102
AA Change: D127E
SMART Domains Protein: ENSMUSP00000099391
Gene: ENSMUSG00000097487
AA Change: D127E

DomainStartEndE-ValueType
Pfam:CS 6 80 7.3e-9 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000107252
AA Change: D145E
SMART Domains Protein: ENSMUSP00000102873
Gene: ENSMUSG00000097487
AA Change: D145E

DomainStartEndE-ValueType
Pfam:CS 6 80 9.6e-9 PFAM
low complexity region 141 149 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107257
SMART Domains Protein: ENSMUSP00000102878
Gene: ENSMUSG00000097239

DomainStartEndE-ValueType
Pfam:tRNA-synt_2c 91 214 1.4e-8 PFAM
tRNA_SAD 309 352 1.43e-6 SMART
low complexity region 389 406 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107259
SMART Domains Protein: ENSMUSP00000102880
Gene: ENSMUSG00000097239

DomainStartEndE-ValueType
Pfam:tRNA-synt_2c 109 232 3.4e-9 PFAM
tRNA_SAD 327 370 1.43e-6 SMART
low complexity region 407 424 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125472
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133240
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140123
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150957
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189049
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185077
Predicted Effect probably benign
Transcript: ENSMUST00000149706
SMART Domains Protein: ENSMUSP00000116399
Gene: ENSMUSG00000097487

DomainStartEndE-ValueType
SCOP:d1ejfa_ 2 41 6e-11 SMART
PDB:1EJF|B 2 56 2e-13 PDB
Meta Mutation Damage Score 0.0908 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency 100% (60/60)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930012K11Rik T A 14: 70,393,392 (GRCm39) H299L probably damaging Het
Abcb4 C T 5: 8,985,180 (GRCm39) A687V probably benign Het
Abtb3 A G 10: 85,465,130 (GRCm39) T657A probably damaging Het
Adam20 A G 8: 41,248,048 (GRCm39) T53A probably benign Het
Afg1l G A 10: 42,330,490 (GRCm39) T59I probably benign Het
AI837181 A G 19: 5,476,329 (GRCm39) Q164R probably benign Het
Anapc15 T A 7: 101,546,974 (GRCm39) I12N probably benign Het
Ankrd55 A C 13: 112,499,988 (GRCm39) E278D probably benign Het
Axin2 A G 11: 108,833,125 (GRCm39) T437A probably benign Het
BC051665 T C 13: 60,931,895 (GRCm39) D168G probably damaging Het
Cd200 C T 16: 45,212,664 (GRCm39) R261H probably benign Het
Clk1 G A 1: 58,460,261 (GRCm39) S123L probably benign Het
Csrnp2 A T 15: 100,382,571 (GRCm39) D156E probably damaging Het
Ctss C T 3: 95,452,695 (GRCm39) Q159* probably null Het
Dennd2b C A 7: 109,156,043 (GRCm39) E236* probably null Het
Dip2a A G 10: 76,157,327 (GRCm39) S93P probably damaging Het
Dnase1l1 C T X: 73,320,644 (GRCm39) probably null Het
Dync1h1 C A 12: 110,624,560 (GRCm39) T3700N probably damaging Het
Ephb6 G A 6: 41,593,743 (GRCm39) R542Q probably benign Het
Fmo3 T C 1: 162,781,880 (GRCm39) D491G possibly damaging Het
Galnt14 A T 17: 73,843,888 (GRCm39) M140K probably benign Het
Ghsr T C 3: 27,425,986 (GRCm39) V14A probably benign Het
Gm17546 C A 15: 95,727,843 (GRCm39) probably benign Het
Gprc5c G T 11: 114,755,093 (GRCm39) V257L possibly damaging Het
Hc A G 2: 34,909,682 (GRCm39) V866A probably benign Het
Hoxb6 G A 11: 96,190,348 (GRCm39) G116R probably damaging Het
Hykk A G 9: 54,827,890 (GRCm39) Y43C probably damaging Het
Jade2 T C 11: 51,711,975 (GRCm39) T495A probably benign Het
Kansl1 A T 11: 104,233,798 (GRCm39) V755E possibly damaging Het
Lrp2 T A 2: 69,309,457 (GRCm39) D2814V probably damaging Het
Mbd5 T A 2: 49,147,009 (GRCm39) N406K probably damaging Het
Met A T 6: 17,491,928 (GRCm39) D230V probably damaging Het
Mrgprx2 A T 7: 48,132,584 (GRCm39) V78D probably damaging Het
Mrpl20 A G 4: 155,892,993 (GRCm39) T112A possibly damaging Het
Nek11 T A 9: 105,040,362 (GRCm39) E566D probably damaging Het
Nostrin T C 2: 69,005,923 (GRCm39) S235P probably damaging Het
Npas4 C A 19: 5,036,805 (GRCm39) S453I probably benign Het
Pnkp C T 7: 44,511,827 (GRCm39) S113L probably damaging Het
Psg18 A T 7: 18,084,711 (GRCm39) Y128* probably null Het
Pus1 T C 5: 110,927,796 (GRCm39) probably benign Het
Raf1 T A 6: 115,621,544 (GRCm39) S12C possibly damaging Het
Rps6-ps2 T G 8: 89,533,206 (GRCm39) noncoding transcript Het
Slc5a4b A G 10: 75,898,073 (GRCm39) L547P probably damaging Het
Socs3 A G 11: 117,858,654 (GRCm39) S135P probably benign Het
Spata31d1e T C 13: 59,890,047 (GRCm39) D591G probably benign Het
Stra6l G A 4: 45,873,682 (GRCm39) V281M possibly damaging Het
Suco G A 1: 161,661,977 (GRCm39) T818I possibly damaging Het
Syde1 A T 10: 78,424,731 (GRCm39) V367D probably damaging Het
Tet3 A T 6: 83,353,865 (GRCm39) L932* probably null Het
Trpm7 G A 2: 126,655,105 (GRCm39) L1278F possibly damaging Het
Vmn1r168 A T 7: 23,240,490 (GRCm39) T116S probably damaging Het
Wfdc6b A G 2: 164,459,214 (GRCm39) Q92R possibly damaging Het
Other mutations in Ptges3l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00851:Ptges3l APN 11 101,314,616 (GRCm39) missense possibly damaging 0.62
IGL01955:Ptges3l APN 11 101,314,644 (GRCm39) missense possibly damaging 0.94
R1183:Ptges3l UTSW 11 101,312,731 (GRCm39) missense possibly damaging 0.79
R1450:Ptges3l UTSW 11 101,312,731 (GRCm39) missense possibly damaging 0.93
R2513:Ptges3l UTSW 11 101,314,868 (GRCm39) missense possibly damaging 0.81
R3830:Ptges3l UTSW 11 101,312,443 (GRCm39) makesense probably null
R4965:Ptges3l UTSW 11 101,315,448 (GRCm39) start codon destroyed probably null 0.32
R7430:Ptges3l UTSW 11 101,314,641 (GRCm39) missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- AGTCGAGTCAGTGGGAAGTC -3'
(R):5'- AGGGTGCACAATAGAGTTCTG -3'

Sequencing Primer
(F):5'- AAGTCATCCCCAGCGGTCAG -3'
(R):5'- GGTGCACAATAGAGTTCTGTTCAC -3'
Posted On 2016-09-07