Incidental Mutation 'R4919:Ino80'
ID 430145
Institutional Source Beutler Lab
Gene Symbol Ino80
Ensembl Gene ENSMUSG00000034154
Gene Name INO80 complex subunit
Synonyms INO80, 2310079N15Rik, 4632409L19Rik, Inoc1
MMRRC Submission 042521-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.961) question?
Stock # R4919 (G1)
Quality Score 178
Status Validated
Chromosome 2
Chromosomal Location 119373042-119477687 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 119442592 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 468 (T468S)
Ref Sequence ENSEMBL: ENSMUSP00000051845 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049920] [ENSMUST00000110808]
AlphaFold Q6ZPV2
Predicted Effect probably damaging
Transcript: ENSMUST00000049920
AA Change: T468S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000051845
Gene: ENSMUSG00000034154
AA Change: T468S

DomainStartEndE-ValueType
coiled coil region 131 165 N/A INTRINSIC
low complexity region 206 242 N/A INTRINSIC
Pfam:DBINO 275 407 6.6e-50 PFAM
low complexity region 474 489 N/A INTRINSIC
DEXDc 516 714 6.27e-37 SMART
low complexity region 907 923 N/A INTRINSIC
HELICc 1134 1217 2.86e-22 SMART
low complexity region 1270 1324 N/A INTRINSIC
low complexity region 1357 1368 N/A INTRINSIC
low complexity region 1424 1436 N/A INTRINSIC
low complexity region 1438 1450 N/A INTRINSIC
low complexity region 1457 1483 N/A INTRINSIC
low complexity region 1510 1521 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000110808
AA Change: T468S

PolyPhen 2 Score 0.825 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000106431
Gene: ENSMUSG00000034154
AA Change: T468S

DomainStartEndE-ValueType
coiled coil region 131 165 N/A INTRINSIC
low complexity region 206 242 N/A INTRINSIC
Pfam:DBINO 272 412 8.8e-55 PFAM
low complexity region 474 489 N/A INTRINSIC
DEXDc 516 714 6.27e-37 SMART
low complexity region 907 923 N/A INTRINSIC
PDB:3MWY|W 1098 1136 6e-7 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138707
Meta Mutation Damage Score 0.0644 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.9%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the chromatin remodeling complex, which is classified into subfamilies depending on sequence features apart from the conserved ATPase domain. This protein is the catalytic ATPase subunit of the INO80 chromatin remodeling complex, which is characterized by a DNA-binding domain. This protein is proposed to bind DNA and be recruited by the YY1 transcription factor to activate certain genes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
PHENOTYPE: Embryos homozygous for a knock-out allele die around E7.5 and show absence of anterior and distal visceral endoderm. Another null allele results in embryonic lethality by E13.5-E14.5 with severe growth retardation and developmental defects. Heterozygotes show defects in hindlimb extension reflex. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
3425401B19Rik T C 14: 32,663,288 D240G possibly damaging Het
Aplf T C 6: 87,630,064 D456G possibly damaging Het
Brd8 A G 18: 34,607,436 F445S probably damaging Het
Coro1b C T 19: 4,150,710 R214C possibly damaging Het
Dopey1 T A 9: 86,520,056 I1101K possibly damaging Het
Enpp1 A G 10: 24,648,085 V728A probably benign Het
Gosr1 T A 11: 76,734,566 probably null Het
Grhl3 T A 4: 135,559,104 K89* probably null Het
Kcnab2 T C 4: 152,401,940 K134E probably damaging Het
Klhl17 C T 4: 156,233,887 V93I possibly damaging Het
Kmt2c G T 5: 25,314,395 P2239Q possibly damaging Het
Lnpep A G 17: 17,578,911 F161L probably damaging Het
Lrp1b T A 2: 40,647,234 I14F probably benign Het
Mbtd1 T A 11: 93,923,148 probably null Het
Musk A C 4: 58,366,899 I506L probably damaging Het
Mydgf C T 17: 56,176,953 V158I probably damaging Het
Ncapd3 C T 9: 27,051,775 P459S possibly damaging Het
Ofcc1 G A 13: 40,015,388 T841I probably damaging Het
Olfr1175-ps A G 2: 88,323,648 V19A probably benign Het
Olfr1361 A T 13: 21,658,624 I233N possibly damaging Het
Olfr525 A T 7: 140,323,514 K272* probably null Het
Pnmt T A 11: 98,386,651 L7Q probably benign Het
Rerg T C 6: 137,056,144 I197V probably damaging Het
Sgo2a T C 1: 57,998,134 S13P probably damaging Het
Sim2 T C 16: 94,109,335 S199P probably benign Het
Smc1b T C 15: 85,117,104 probably benign Het
Spata7 T C 12: 98,648,453 S115P possibly damaging Het
Ssh2 A G 11: 77,425,320 T250A possibly damaging Het
Sv2a A G 3: 96,190,755 N558S probably benign Het
Tia1 T A 6: 86,424,323 probably benign Het
Tmem39a A G 16: 38,585,199 Y46C probably benign Het
Vmn2r2 A G 3: 64,117,157 S668P possibly damaging Het
Vwa1 C A 4: 155,770,600 A326S probably benign Het
Xpo6 A G 7: 126,152,943 M327T probably benign Het
Other mutations in Ino80
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01402:Ino80 APN 2 119456718 missense possibly damaging 0.83
IGL01404:Ino80 APN 2 119456718 missense possibly damaging 0.83
IGL01985:Ino80 APN 2 119433321 missense probably damaging 0.99
IGL02039:Ino80 APN 2 119380073 missense probably damaging 1.00
IGL02187:Ino80 APN 2 119445457 splice site probably benign
IGL02726:Ino80 APN 2 119442483 missense probably damaging 1.00
Chosen UTSW 2 119382269 splice site probably null
PIT4677001:Ino80 UTSW 2 119377545 missense probably benign
R0004:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0004:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0057:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0113:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0114:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0115:Ino80 UTSW 2 119431016 missense probably damaging 1.00
R0138:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0189:Ino80 UTSW 2 119379679 missense probably benign 0.36
R0363:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0364:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0365:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0481:Ino80 UTSW 2 119431016 missense probably damaging 1.00
R0532:Ino80 UTSW 2 119381983 missense possibly damaging 0.79
R0580:Ino80 UTSW 2 119383481 missense probably damaging 1.00
R0610:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0675:Ino80 UTSW 2 119383481 missense probably damaging 1.00
R1275:Ino80 UTSW 2 119427055 missense probably benign 0.12
R1470:Ino80 UTSW 2 119379649 missense probably damaging 1.00
R1470:Ino80 UTSW 2 119379649 missense probably damaging 1.00
R1506:Ino80 UTSW 2 119425265 nonsense probably null
R1510:Ino80 UTSW 2 119450049 missense probably damaging 1.00
R1570:Ino80 UTSW 2 119447028 missense possibly damaging 0.68
R1613:Ino80 UTSW 2 119392867 missense probably damaging 1.00
R1673:Ino80 UTSW 2 119381936 missense probably damaging 1.00
R1773:Ino80 UTSW 2 119418409 missense probably benign 0.18
R1795:Ino80 UTSW 2 119406859 missense probably damaging 1.00
R2093:Ino80 UTSW 2 119426670 missense possibly damaging 0.55
R2105:Ino80 UTSW 2 119431929 missense probably null 1.00
R2113:Ino80 UTSW 2 119454084 missense probably damaging 1.00
R3618:Ino80 UTSW 2 119446872 missense probably null 0.81
R4572:Ino80 UTSW 2 119402358 missense probably damaging 1.00
R4649:Ino80 UTSW 2 119431008 missense probably damaging 1.00
R5113:Ino80 UTSW 2 119431945 missense probably damaging 1.00
R5138:Ino80 UTSW 2 119383421 missense probably damaging 1.00
R5458:Ino80 UTSW 2 119412429 missense possibly damaging 0.50
R5499:Ino80 UTSW 2 119441647 missense probably damaging 1.00
R5502:Ino80 UTSW 2 119402396 missense probably damaging 1.00
R5531:Ino80 UTSW 2 119445575 missense probably benign
R5740:Ino80 UTSW 2 119431029 missense probably damaging 1.00
R5892:Ino80 UTSW 2 119439547 intron probably benign
R5914:Ino80 UTSW 2 119458216 missense probably damaging 0.99
R6000:Ino80 UTSW 2 119374508 missense probably benign 0.04
R6263:Ino80 UTSW 2 119383414 missense probably damaging 1.00
R6505:Ino80 UTSW 2 119451441 missense probably damaging 1.00
R6942:Ino80 UTSW 2 119383502 missense probably damaging 0.99
R7052:Ino80 UTSW 2 119426587 critical splice donor site probably null
R7100:Ino80 UTSW 2 119374513 missense possibly damaging 0.47
R7163:Ino80 UTSW 2 119392875 missense probably damaging 1.00
R7187:Ino80 UTSW 2 119426591 missense probably benign 0.00
R7202:Ino80 UTSW 2 119374437 missense probably benign 0.00
R7218:Ino80 UTSW 2 119458127 missense probably benign
R7389:Ino80 UTSW 2 119442529 missense probably benign 0.00
R7419:Ino80 UTSW 2 119380014 missense probably benign 0.00
R7437:Ino80 UTSW 2 119442586 missense possibly damaging 0.86
R7607:Ino80 UTSW 2 119382269 splice site probably null
R7702:Ino80 UTSW 2 119442573 missense probably benign 0.01
R7975:Ino80 UTSW 2 119456467 splice site probably null
R7978:Ino80 UTSW 2 119439393 missense possibly damaging 0.93
R8376:Ino80 UTSW 2 119442487 missense probably benign 0.14
R8469:Ino80 UTSW 2 119379593 missense probably benign
R8720:Ino80 UTSW 2 119402387 missense probably damaging 1.00
R8751:Ino80 UTSW 2 119406908 missense probably benign
R8958:Ino80 UTSW 2 119383381 missense probably damaging 1.00
R8992:Ino80 UTSW 2 119379578 missense possibly damaging 0.93
R9319:Ino80 UTSW 2 119374524 missense probably benign 0.13
R9346:Ino80 UTSW 2 119426958 missense possibly damaging 0.54
R9370:Ino80 UTSW 2 119402367 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGCCTTTCAGCTGGTAACC -3'
(R):5'- ATAGTCTCCTATGTACCCAAACTC -3'

Sequencing Primer
(F):5'- AGCTGGTAACCTTTCAACTTGC -3'
(R):5'- CCCAAACTCTTATATCAGAACTTGG -3'
Posted On 2016-09-07