Incidental Mutation 'R4919:Grhl3'
ID430146
Institutional Source Beutler Lab
Gene Symbol Grhl3
Ensembl Gene ENSMUSG00000037188
Gene Namegrainyhead like transcription factor 3
SynonymsSom, ct, Get1
MMRRC Submission 042521-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.922) question?
Stock #R4919 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location135541888-135573630 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 135559104 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 89 (K89*)
Ref Sequence ENSEMBL: ENSMUSP00000101481 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105855]
Predicted Effect probably null
Transcript: ENSMUST00000105855
AA Change: K89*
SMART Domains Protein: ENSMUSP00000101481
Gene: ENSMUSG00000037188
AA Change: K89*

DomainStartEndE-ValueType
Pfam:CP2 215 421 2.5e-81 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.9%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the grainyhead family of transcription factors. The encoded protein may function as a transcription factor during development, and has been shown to stimulate migration of endothelial cells. Multiple transcript variants encoding distinct isoforms have been identified for this gene.[provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for the variably penetrant curly-tail mutation (ct) show symptoms of cranial or spinal neural tube defects such as curly tails and/or spina bifida; homozygotes with more severe phenotypes display exencephaly and die in utero. Homozygous knockout mice show severe neural tube defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
3425401B19Rik T C 14: 32,663,288 D240G possibly damaging Het
Aplf T C 6: 87,630,064 D456G possibly damaging Het
Brd8 A G 18: 34,607,436 F445S probably damaging Het
Coro1b C T 19: 4,150,710 R214C possibly damaging Het
Dopey1 T A 9: 86,520,056 I1101K possibly damaging Het
Enpp1 A G 10: 24,648,085 V728A probably benign Het
Gosr1 T A 11: 76,734,566 probably null Het
Ino80 T A 2: 119,442,592 T468S probably damaging Het
Kcnab2 T C 4: 152,401,940 K134E probably damaging Het
Klhl17 C T 4: 156,233,887 V93I possibly damaging Het
Kmt2c G T 5: 25,314,395 P2239Q possibly damaging Het
Lnpep A G 17: 17,578,911 F161L probably damaging Het
Lrp1b T A 2: 40,647,234 I14F probably benign Het
Mbtd1 T A 11: 93,923,148 probably null Het
Musk A C 4: 58,366,899 I506L probably damaging Het
Mydgf C T 17: 56,176,953 V158I probably damaging Het
Ncapd3 C T 9: 27,051,775 P459S possibly damaging Het
Ofcc1 G A 13: 40,015,388 T841I probably damaging Het
Olfr1175-ps A G 2: 88,323,648 V19A probably benign Het
Olfr1361 A T 13: 21,658,624 I233N possibly damaging Het
Olfr525 A T 7: 140,323,514 K272* probably null Het
Pnmt T A 11: 98,386,651 L7Q probably benign Het
Rerg T C 6: 137,056,144 I197V probably damaging Het
Sgo2a T C 1: 57,998,134 S13P probably damaging Het
Sim2 T C 16: 94,109,335 S199P probably benign Het
Smc1b T C 15: 85,117,104 probably benign Het
Spata7 T C 12: 98,648,453 S115P possibly damaging Het
Ssh2 A G 11: 77,425,320 T250A possibly damaging Het
Sv2a A G 3: 96,190,755 N558S probably benign Het
Tia1 T A 6: 86,424,323 probably benign Het
Tmem39a A G 16: 38,585,199 Y46C probably benign Het
Vmn2r2 A G 3: 64,117,157 S668P possibly damaging Het
Vwa1 C A 4: 155,770,600 A326S probably benign Het
Xpo6 A G 7: 126,152,943 M327T probably benign Het
Other mutations in Grhl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02638:Grhl3 APN 4 135556865 missense probably benign 0.00
IGL02868:Grhl3 APN 4 135554604 missense probably damaging 1.00
Bite-size UTSW 4 135557433 missense possibly damaging 0.46
hammerkop UTSW 4 135546246 missense probably damaging 1.00
hoopoe UTSW 4 135559146 missense probably benign 0.00
R0121:Grhl3 UTSW 4 135552549 missense probably damaging 0.97
R0180:Grhl3 UTSW 4 135554530 missense probably benign 0.00
R0627:Grhl3 UTSW 4 135552681 missense probably benign 0.18
R0727:Grhl3 UTSW 4 135546254 missense possibly damaging 0.90
R1248:Grhl3 UTSW 4 135561306 missense probably benign 0.01
R1664:Grhl3 UTSW 4 135552550 missense probably benign 0.11
R2910:Grhl3 UTSW 4 135559146 missense probably benign 0.00
R2911:Grhl3 UTSW 4 135559146 missense probably benign 0.00
R3773:Grhl3 UTSW 4 135555847 nonsense probably null
R4033:Grhl3 UTSW 4 135573424 start codon destroyed probably benign
R4521:Grhl3 UTSW 4 135546250 missense probably damaging 1.00
R4576:Grhl3 UTSW 4 135561251 missense probably damaging 1.00
R4650:Grhl3 UTSW 4 135549236 splice site probably null
R4697:Grhl3 UTSW 4 135548466 missense probably damaging 1.00
R4920:Grhl3 UTSW 4 135559104 nonsense probably null
R4961:Grhl3 UTSW 4 135552607 missense probably damaging 1.00
R5100:Grhl3 UTSW 4 135542675 missense probably benign
R5180:Grhl3 UTSW 4 135559104 nonsense probably null
R5181:Grhl3 UTSW 4 135559104 nonsense probably null
R5325:Grhl3 UTSW 4 135559104 nonsense probably null
R6429:Grhl3 UTSW 4 135557196 missense probably damaging 0.99
R6459:Grhl3 UTSW 4 135557433 missense possibly damaging 0.46
R7047:Grhl3 UTSW 4 135549240 splice site probably null
R7073:Grhl3 UTSW 4 135573412 missense probably benign 0.00
R7345:Grhl3 UTSW 4 135546246 missense probably damaging 1.00
R7797:Grhl3 UTSW 4 135559105 missense possibly damaging 0.93
R7829:Grhl3 UTSW 4 135561221 missense probably damaging 0.98
R8023:Grhl3 UTSW 4 135550329 missense probably benign
Z1177:Grhl3 UTSW 4 135552686 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TGGCTGTTCTGAAACCTCCC -3'
(R):5'- TGAAACACTCACTTTTCTCCCAAG -3'

Sequencing Primer
(F):5'- GAAACCTCCCCATTGCACCTATTG -3'
(R):5'- TTCTCCCAAGCGTTCCAGGG -3'
Posted On2016-09-07