Incidental Mutation 'R4776:Sp140'
ID430164
Institutional Source Beutler Lab
Gene Symbol Sp140
Ensembl Gene ENSMUSG00000070031
Gene NameSp140 nuclear body protein
Synonyms
MMRRC Submission 042413-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.440) question?
Stock #R4776 (G1)
Quality Score33
Status Validated
Chromosome1
Chromosomal Location85600378-85645037 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 85610828 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 95 (D95E)
Ref Sequence ENSEMBL: ENSMUSP00000079095 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080204] [ENSMUST00000113385]
Predicted Effect possibly damaging
Transcript: ENSMUST00000080204
AA Change: D95E

PolyPhen 2 Score 0.460 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000079095
Gene: ENSMUSG00000070031
AA Change: D95E

DomainStartEndE-ValueType
Pfam:Sp100 24 121 5.1e-40 PFAM
low complexity region 213 223 N/A INTRINSIC
low complexity region 240 248 N/A INTRINSIC
SAND 256 329 4.17e-34 SMART
PHD 360 402 3.7e-8 SMART
BROMO 423 526 4.49e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113385
Predicted Effect noncoding transcript
Transcript: ENSMUST00000113396
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161763
Predicted Effect probably benign
Transcript: ENSMUST00000162925
SMART Domains Protein: ENSMUSP00000123756
Gene: ENSMUSG00000070031

DomainStartEndE-ValueType
low complexity region 117 127 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 98% (94/96)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SP100 family of proteins, which are share common domains including an N-terminal homogeneously staining region domain followed by a SP100/autoimmune regulator/NucP41/P75/deformed epidermal autoregulatory factor domain, a plant homeobox zinc finger, and a bromodomain. The encoded protein is interferon-inducible and is expressed at high levels in the nuclei of leukocytes. Variants of this gene have been associated with multiple sclerosis, Crohn's disease, and chronic lymphocytic leukemia. Alternative splicing results in multiple variants. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T A 1: 105,719,535 Y683* probably null Het
2610028H24Rik A T 10: 76,457,512 M156L probably benign Het
4930470P17Rik C T 2: 170,579,724 A79T unknown Het
4930522L14Rik A G 5: 109,736,873 I373T probably benign Het
A830010M20Rik C A 5: 107,510,451 A1117E probably damaging Het
Amotl1 G A 9: 14,593,373 Q217* probably null Het
Ankrd28 A T 14: 31,732,054 C254S probably damaging Het
Ap2a1 A G 7: 44,901,546 probably benign Het
Arfgef3 A T 10: 18,654,247 S245T probably benign Het
Arntl A T 7: 113,285,037 K94I probably damaging Het
Atp1b2 A T 11: 69,601,561 D224E probably damaging Het
Boc G A 16: 44,487,721 R924W probably damaging Het
Car14 C T 3: 95,898,873 G292D probably benign Het
Cenpb T C 2: 131,178,183 probably benign Het
Ces1b A T 8: 93,063,030 D423E possibly damaging Het
Cfap54 T A 10: 92,972,694 N1373I possibly damaging Het
Chrdl2 T C 7: 100,006,541 probably benign Het
Cic T G 7: 25,282,883 S12A possibly damaging Het
Csmd2 A T 4: 128,442,892 Q1421L probably benign Het
D630039A03Rik T C 4: 57,910,452 H120R possibly damaging Het
Dicer1 T A 12: 104,692,446 D1779V probably damaging Het
Dock9 G T 14: 121,610,097 H1016N possibly damaging Het
Dxo T C 17: 34,838,998 L352P probably damaging Het
Eif2b5 T A 16: 20,500,233 F78I probably damaging Het
Eri2 A G 7: 119,784,946 probably benign Het
Fam208b A G 13: 3,570,391 F2170S probably damaging Het
Fbxw7 T G 3: 84,925,689 L13V possibly damaging Het
Fgf7 T A 2: 126,035,783 C23* probably null Het
Fubp1 T A 3: 152,222,068 probably null Het
Gm2663 A T 6: 40,995,953 I240N probably damaging Het
Gnb1l C T 16: 18,548,096 Q140* probably null Het
Gnptab G A 10: 88,436,528 R1010Q probably damaging Het
Gtf2h1 G A 7: 46,822,878 W544* probably null Het
Gucy2c C T 6: 136,722,514 E586K probably damaging Het
Hc T A 2: 35,039,734 E232V probably benign Het
Ifi207 T A 1: 173,730,056 D372V unknown Het
Igkv8-28 A T 6: 70,144,118 V15E probably benign Het
Il1rap A G 16: 26,692,799 S198G possibly damaging Het
Lct A G 1: 128,300,387 I1123T probably damaging Het
Lhcgr T C 17: 88,742,697 E467G probably damaging Het
Macf1 C T 4: 123,476,015 R86K probably benign Het
Maml3 T A 3: 51,856,532 Q337L probably benign Het
March10 T A 11: 105,390,037 D474V probably benign Het
March2 G T 17: 33,709,916 T2K probably damaging Het
Mast1 A G 8: 84,937,193 probably null Het
Med12l T C 3: 59,233,212 I868T probably damaging Het
Msrb1 T C 17: 24,740,173 S100P probably damaging Het
Nlrp4c T C 7: 6,066,126 L342P probably benign Het
Nrxn3 T A 12: 90,331,956 V417E possibly damaging Het
Ntng1 T A 3: 109,934,713 D248V probably damaging Het
Oaz3 T C 3: 94,434,998 Q117R probably benign Het
Olfr1311 A G 2: 112,020,931 Y308H probably benign Het
Olfr444 A G 6: 42,955,521 I8V probably benign Het
Olfr589 A G 7: 103,155,414 L111P probably benign Het
Osbpl3 A C 6: 50,300,973 S767A probably benign Het
Pafah1b1 A T 11: 74,685,871 probably benign Het
Pard6b A G 2: 168,098,788 T232A probably damaging Het
Paxip1 A T 5: 27,765,206 C596S probably damaging Het
Pnpla6 T C 8: 3,523,818 V422A probably benign Het
Psmd6 A T 14: 14,120,932 probably benign Het
Rock2 T A 12: 16,977,740 C1353S probably damaging Het
Rpl31-ps17 C T 12: 54,701,612 noncoding transcript Het
Sel1l T A 12: 91,813,893 H658L probably damaging Het
Sh3yl1 T A 12: 30,940,314 L105Q probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Sirt1 T C 10: 63,335,722 K227E probably benign Het
Slc25a34 A T 4: 141,623,588 F37I possibly damaging Het
Slc39a5 T A 10: 128,397,049 I378F probably damaging Het
Smarcad1 A T 6: 65,098,824 D731V probably null Het
Sox6 T G 7: 115,541,670 K483N probably damaging Het
Srgap1 G T 10: 121,792,351 D882E probably benign Het
Syne4 T C 7: 30,316,833 probably benign Het
Tec T C 5: 72,768,776 Y289C probably benign Het
Tmem102 A T 11: 69,804,802 Y115N probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trav17 T A 14: 53,806,640 M1K probably null Het
Trdn T A 10: 33,399,082 probably null Het
Trp53 A T 11: 69,586,921 I8F probably benign Het
Ttn T A 2: 76,754,662 D22064V probably damaging Het
Ube3c G A 5: 29,632,838 probably null Het
Ulk1 C T 5: 110,788,947 probably null Het
Upp1 T C 11: 9,135,976 V271A probably damaging Het
Vmn2r4 T C 3: 64,388,661 E901G probably damaging Het
Vmn2r96 G A 17: 18,597,508 G449D probably damaging Het
Vps37b T C 5: 124,006,612 K165E probably damaging Het
Vwf A T 6: 125,566,305 I185F possibly damaging Het
Wasf2 A G 4: 133,185,004 T56A probably benign Het
Zdhhc23 C G 16: 43,973,589 D241H possibly damaging Het
Zfp276 T C 8: 123,254,884 S57P probably benign Het
Zxdc A G 6: 90,370,518 H287R probably damaging Het
Other mutations in Sp140
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Sp140 APN 1 85641822 nonsense probably null
IGL00561:Sp140 APN 1 85621672 missense probably benign 0.00
IGL00572:Sp140 APN 1 85621672 missense probably benign 0.00
IGL00591:Sp140 APN 1 85621672 missense probably benign 0.00
IGL00990:Sp140 APN 1 85626165 missense possibly damaging 0.59
IGL00990:Sp140 APN 1 85626133 missense probably benign 0.00
IGL02106:Sp140 APN 1 85643219 missense probably benign 0.01
IGL02303:Sp140 APN 1 85643009 nonsense probably null
PIT4131001:Sp140 UTSW 1 85601172 missense probably benign 0.03
PIT4131001:Sp140 UTSW 1 85610882 missense probably benign 0.03
PIT4131001:Sp140 UTSW 1 85643221 missense probably benign
PIT4142001:Sp140 UTSW 1 85601172 missense probably benign 0.03
PIT4142001:Sp140 UTSW 1 85610882 missense probably benign 0.03
PIT4142001:Sp140 UTSW 1 85643221 missense probably benign
R0378:Sp140 UTSW 1 85620051 splice site probably benign
R0815:Sp140 UTSW 1 85620051 splice site probably benign
R1320:Sp140 UTSW 1 85635608 critical splice donor site probably null
R1642:Sp140 UTSW 1 85610824 splice site probably null
R1791:Sp140 UTSW 1 85620051 splice site probably benign
R4780:Sp140 UTSW 1 85610828 missense possibly damaging 0.46
R4839:Sp140 UTSW 1 85610808 unclassified probably benign
R5051:Sp140 UTSW 1 85610828 missense possibly damaging 0.46
R5287:Sp140 UTSW 1 85610824 splice site probably null
R5379:Sp140 UTSW 1 85610828 missense possibly damaging 0.46
R6518:Sp140 UTSW 1 85644570 critical splice acceptor site probably benign
R7125:Sp140 UTSW 1 85644569 critical splice acceptor site probably benign
R7128:Sp140 UTSW 1 85620125 missense possibly damaging 0.63
R7785:Sp140 UTSW 1 85620098 missense probably benign 0.00
R8033:Sp140 UTSW 1 85620094 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCTTGGTATTTGCAAAACTCAGAC -3'
(R):5'- TGTGCTTGGCATGACATAGTCTC -3'

Sequencing Primer
(F):5'- GTTTGAACCAATGTAAGCC -3'
(R):5'- CTGGTCTACAAAGTGAGCTCCAG -3'
Posted On2016-09-07