Incidental Mutation 'R4850:Gm10718'
ID430169
Institutional Source Beutler Lab
Gene Symbol Gm10718
Ensembl Gene ENSMUSG00000095186
Gene Namepredicted gene 10718
Synonyms
MMRRC Submission 042462-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.548) question?
Stock #R4850 (G1)
Quality Score21
Status Validated
Chromosome9
Chromosomal Location3023547-3025218 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 3023716 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 56 (T56S)
Ref Sequence ENSEMBL: ENSMUSP00000096645 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075573] [ENSMUST00000099046] [ENSMUST00000099047] [ENSMUST00000099049] [ENSMUST00000177601] [ENSMUST00000177875] [ENSMUST00000179272] [ENSMUST00000179982]
Predicted Effect probably benign
Transcript: ENSMUST00000075573
SMART Domains Protein: ENSMUSP00000096644
Gene: ENSMUSG00000095891

DomainStartEndE-ValueType
internal_repeat_1 1 41 1.06e-10 PROSPERO
transmembrane domain 68 90 N/A INTRINSIC
internal_repeat_1 118 177 1.06e-10 PROSPERO
transmembrane domain 200 222 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099046
AA Change: T56S

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000096645
Gene: ENSMUSG00000095186
AA Change: T56S

DomainStartEndE-ValueType
internal_repeat_1 1 41 4.44e-7 PROSPERO
transmembrane domain 67 89 N/A INTRINSIC
internal_repeat_1 117 177 4.44e-7 PROSPERO
transmembrane domain 197 219 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099047
SMART Domains Protein: ENSMUSP00000096646
Gene: ENSMUSG00000095547

DomainStartEndE-ValueType
internal_repeat_1 1 40 1.58e-10 PROSPERO
transmembrane domain 53 72 N/A INTRINSIC
transmembrane domain 77 99 N/A INTRINSIC
internal_repeat_1 117 176 1.58e-10 PROSPERO
transmembrane domain 199 221 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099049
SMART Domains Protein: ENSMUSP00000096648
Gene: ENSMUSG00000095547

DomainStartEndE-ValueType
internal_repeat_1 1 46 2.19e-9 PROSPERO
transmembrane domain 62 84 N/A INTRINSIC
internal_repeat_1 117 182 2.19e-9 PROSPERO
transmembrane domain 197 219 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177601
SMART Domains Protein: ENSMUSP00000136755
Gene: ENSMUSG00000095891

DomainStartEndE-ValueType
internal_repeat_2 1 24 2.26e-6 PROSPERO
internal_repeat_1 2 37 2.26e-6 PROSPERO
internal_repeat_1 40 95 2.26e-6 PROSPERO
internal_repeat_2 118 142 2.26e-6 PROSPERO
low complexity region 147 159 N/A INTRINSIC
low complexity region 169 183 N/A INTRINSIC
transmembrane domain 186 208 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177875
SMART Domains Protein: ENSMUSP00000137419
Gene: ENSMUSG00000095891

DomainStartEndE-ValueType
internal_repeat_1 1 49 1.49e-11 PROSPERO
transmembrane domain 68 90 N/A INTRINSIC
internal_repeat_1 118 186 1.49e-11 PROSPERO
transmembrane domain 197 219 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000179272
SMART Domains Protein: ENSMUSP00000136170
Gene: ENSMUSG00000095547

DomainStartEndE-ValueType
internal_repeat_1 1 49 2.1e-10 PROSPERO
transmembrane domain 74 96 N/A INTRINSIC
internal_repeat_1 118 186 2.1e-10 PROSPERO
transmembrane domain 198 217 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000179982
SMART Domains Protein: ENSMUSP00000136365
Gene: ENSMUSG00000095891

DomainStartEndE-ValueType
internal_repeat_1 1 35 7.76e-13 PROSPERO
transmembrane domain 67 89 N/A INTRINSIC
internal_repeat_1 117 152 7.76e-13 PROSPERO
low complexity region 157 169 N/A INTRINSIC
transmembrane domain 198 220 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181572
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181957
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 99% (79/80)
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,262,938 S3012P unknown Het
Abcb10 C T 8: 123,982,690 A42T probably benign Het
Acsf3 T C 8: 122,817,436 V551A probably damaging Het
Adgrl2 G A 3: 148,859,020 T304I probably damaging Het
Akr1d1 A G 6: 37,554,587 probably null Het
Ankrd17 A T 5: 90,264,786 H1226Q probably damaging Het
Arap1 T C 7: 101,398,791 I847T probably damaging Het
Atad2b G A 12: 4,943,251 G257S probably benign Het
Cand2 A T 6: 115,801,948 T1158S probably benign Het
Cic G A 7: 25,272,902 R686H probably damaging Het
Cldn1 T A 16: 26,363,163 T99S probably benign Het
Cnga3 G T 1: 37,258,006 E173* probably null Het
Cryge G T 1: 65,051,052 probably benign Het
Dsp T A 13: 38,192,469 L1410H probably damaging Het
Dync2h1 T C 9: 7,134,364 T1548A probably benign Het
Dysf C A 6: 84,097,715 D499E probably damaging Het
Eml5 T C 12: 98,790,619 D1917G probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam71d A G 12: 78,715,153 D197G probably damaging Het
Fn3krp A T 11: 121,425,053 H90L possibly damaging Het
Gm4847 A T 1: 166,642,339 I55K probably damaging Het
Gsn T A 2: 35,283,900 probably null Het
Haghl T C 17: 25,783,006 probably benign Het
Hist1h2bj G T 13: 22,043,251 probably benign Het
Hmg20b T A 10: 81,346,927 E139V probably damaging Het
Hsd3b6 G A 3: 98,807,905 T57I probably benign Het
Igkv5-48 A G 6: 69,726,796 S42P probably damaging Het
Igsf23 T C 7: 19,953,934 probably benign Het
Kcnt1 T C 2: 25,908,100 F874L probably damaging Het
Maf1 T C 15: 76,352,962 F110L possibly damaging Het
Mtpap C T 18: 4,387,044 R365W probably damaging Het
Mtus1 A C 8: 41,084,470 S70A possibly damaging Het
Nfatc1 T A 18: 80,697,865 T307S probably benign Het
Nphs1 T G 7: 30,463,232 S379A possibly damaging Het
Nup205 A G 6: 35,230,530 T1506A probably benign Het
Olfr1044 T A 2: 86,171,671 I49F probably damaging Het
Olfr275 T C 4: 52,825,450 S18P possibly damaging Het
Pcdhga8 A T 18: 37,727,709 Y606F probably damaging Het
Pde7a A G 3: 19,243,117 V123A probably benign Het
Pex1 C T 5: 3,624,426 T809I probably benign Het
Prdm13 C A 4: 21,678,243 R749L possibly damaging Het
Prkcd A G 14: 30,599,743 L498P probably damaging Het
Pros1 A T 16: 62,885,524 E67V probably damaging Het
Rab44 A G 17: 29,140,089 E417G possibly damaging Het
Rangrf A G 11: 68,973,640 probably null Het
Rp1 T A 1: 4,348,675 K738M probably damaging Het
Ryr2 A T 13: 11,668,820 D3119E probably damaging Het
Ryr2 G A 13: 11,745,752 R1482C probably damaging Het
Sbspon T A 1: 15,858,968 T200S probably damaging Het
Sfxn5 T C 6: 85,332,376 probably benign Het
Slc26a8 T A 17: 28,654,883 I377F probably benign Het
Slc30a7 A G 3: 115,993,008 F72L probably damaging Het
Slc32a1 T C 2: 158,614,192 F256L possibly damaging Het
Slco6b1 T C 1: 96,911,833 noncoding transcript Het
Smpd1 A G 7: 105,555,985 H357R probably benign Het
Sncaip A T 18: 52,871,384 H361L probably damaging Het
Tenm2 A C 11: 36,023,488 Y2406* probably null Het
Terb1 T A 8: 104,485,425 H308L probably benign Het
Trim61 A T 8: 65,013,418 L397H probably damaging Het
Trp53bp1 T A 2: 121,205,113 probably null Het
Ttn T G 2: 76,781,555 E9007D possibly damaging Het
Urb1 A T 16: 90,795,414 C319* probably null Het
Vmn2r95 T C 17: 18,451,653 Y551H probably damaging Het
Vwde A T 6: 13,196,048 V326D possibly damaging Het
Xdh A G 17: 73,898,335 L1045P probably damaging Het
Zfp638 T C 6: 83,979,475 I1688T possibly damaging Het
Zwint T A 10: 72,655,956 probably benign Het
Other mutations in Gm10718
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01863:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01865:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01867:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01868:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01869:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01870:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01871:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01874:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01877:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01878:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01879:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01880:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01881:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01883:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01884:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01885:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01886:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01887:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01888:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01890:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01891:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01894:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01895:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01896:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01897:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01898:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01901:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01903:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01904:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01905:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01908:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01909:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01910:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01912:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01917:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01918:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01919:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01920:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01924:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01925:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01926:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01928:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01929:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01932:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01933:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01934:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01937:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01938:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01941:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01944:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01945:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01946:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01947:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01949:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01950:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01951:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01952:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01953:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01958:Gm10718 APN 9 3025118 missense probably benign 0.00
PIT4131001:Gm10718 UTSW 9 3024417 missense probably benign 0.01
PIT4142001:Gm10718 UTSW 9 3024417 missense probably benign 0.01
R4567:Gm10718 UTSW 9 3023716 missense probably benign 0.01
RF039:Gm10718 UTSW 9 3024385 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GGTCCTACAGTGTGCATTTCTCA -3'
(R):5'- ATTTCCACTGTAGGACATGGAA -3'

Sequencing Primer
(F):5'- CAAGTCGTCAAGTGGATGTTTCTC -3'
(R):5'- TTCCACTGTAGGACATGGAATATGGC -3'
Posted On2016-09-07