Mutagenetix > Incidental Mutations

Incidental Mutation 'R4815:Trpm7'

430202

Institutional Source

Beutler Lab

Gene Symbol

Trpm7

Ensembl Gene

ENSMUSG00000027365

Gene Name

transient receptor potential cation channel, subfamily M, member 7

Synonyms

LTRPC7, 2310022G15Rik, CHAK, CHAK1, Ltpr7, 4833414K03Rik, 5033407O22Rik, TRP-PLIK

MMRRC Submission

042433-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4815 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

126791565-126876230 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 126858492 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 2 (S2P)

Ref Sequence

ENSEMBL: ENSMUSP00000099513 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028843] [ENSMUST00000103224]

PDB Structure

CRYSTAL STRUCTURE OF THE ATYPICAL PROTEIN KINASE DOMAIN OF A TRP CA-CHANNEL, CHAK (AMPPNP COMPLEX) [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE ATYPICAL PROTEIN KINASE DOMAIN OF A TRP CA-CHANNEL, CHAK (ADP-MG COMPLEX) [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE ATYPICAL PROTEIN KINASE DOMAIN OF A TRP CA-CHANNEL, CHAK (APO) [X-RAY DIFFRACTION]

Predicted Effect

probably damaging
Transcript: ENSMUST00000028843
AA Change: S2P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000028843
Gene: ENSMUSG00000027365
AA Change: S2P

Domain	Start	End	E-Value	Type
Blast:ANK	438	467	5e-6	BLAST
low complexity region	541	555	N/A	INTRINSIC
transmembrane domain	757	774	N/A	INTRINSIC
transmembrane domain	853	875	N/A	INTRINSIC
Pfam:Ion_trans	887	1096	3e-8	PFAM
PDB:3E7K\|H	1198	1249	6e-27	PDB
low complexity region	1385	1397	N/A	INTRINSIC
Blast:Alpha_kinase	1398	1545	6e-64	BLAST
Alpha_kinase	1596	1813	3.77e-89	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000103224
AA Change: S2P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000099513
Gene: ENSMUSG00000027365
AA Change: S2P

Domain	Start	End	E-Value	Type
Blast:ANK	438	467	5e-6	BLAST
low complexity region	541	555	N/A	INTRINSIC
transmembrane domain	757	774	N/A	INTRINSIC
Pfam:Ion_trans	855	1108	1.7e-9	PFAM
Pfam:TRPM_tetra	1194	1249	3.3e-29	PFAM
low complexity region	1385	1397	N/A	INTRINSIC
Blast:Alpha_kinase	1398	1546	2e-64	BLAST
Alpha_kinase	1597	1814	3.77e-89	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134408

Meta Mutation Damage Score

0.1758

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.6%
20x: 93.5%

Validation Efficiency

96% (76/79)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is both an ion channel and a serine/threonine protein kinase. The kinase activity is essential for the ion channel function, which serves to increase intracellular calcium levels and to help regulate magnesium ion homeostasis. Defects in this gene are a cause of amyotrophic lateral sclerosis-parkinsonism/dementia complex of Guam. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a null allele display embryonic lehality. Mice with conditional deletion in developing thymocytes display a block in thymopoiesis. Mice homozygous for a kinase deleted allele exhibit prenatal lethality. Mice heterozygous for this allele exhibit altered magnesium homeostasis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Alpk2	A	T	18: 65,349,955	N327K	probably damaging	Het
Ank2	T	C	3: 126,936,761	T675A	probably benign	Het
Arap3	T	C	18: 37,973,243	T1516A	probably benign	Het
Asb18	A	T	1: 90,014,425	N51K	probably damaging	Het
BC003331	A	G	1: 150,374,846	C294R	probably damaging	Het
C7	A	G	15: 5,059,405	V18A	probably benign	Het
Caap1	A	G	4: 94,501,260	V279A	probably benign	Het
Cacnb2	A	G	2: 14,874,780	D21G	probably damaging	Het
Ccdc171	T	C	4: 83,795,221	S1166P	probably damaging	Het
Chgb	A	T	2: 132,793,299	H387L	probably benign	Het
Chp2	G	A	7: 122,220,900	R91Q	probably damaging	Het
Chuk	C	A	19: 44,077,247	G703*	probably null	Het
Clmn	T	C	12: 104,785,566	D210G	probably damaging	Het
Cyp4f18	A	G	8: 71,995,995	V270A	possibly damaging	Het
Dgcr2	A	G	16: 17,858,619		probably benign	Het
Diaph1	A	T	18: 37,895,203	V411D	unknown	Het
Dkk2	C	T	3: 132,173,785	A75V	probably benign	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Het
Dnase2a	T	C	8: 84,909,877	V187A	probably benign	Het
Dusp19	A	G	2: 80,630,945	M193V	probably benign	Het
Ear-ps2	G	A	14: 44,047,060		noncoding transcript	Het
Gm37596	C	T	3: 93,692,286	V259M	probably benign	Het
Golgb1	A	T	16: 36,913,115	Q908L	possibly damaging	Het
Hsp90aa1	T	C	12: 110,695,226	M119V	possibly damaging	Het
Ice2	C	T	9: 69,407,118	R50C	probably damaging	Het
Ifi208	A	T	1: 173,682,837	E186V	probably damaging	Het
Ift122	A	G	6: 115,881,556	K166E	possibly damaging	Het
Jcad	T	A	18: 4,675,223	L995Q	possibly damaging	Het
Kcnc4	A	T	3: 107,458,266	C209S	probably benign	Het
Kmt2a	G	A	9: 44,821,256		probably benign	Het
Lrriq1	T	A	10: 103,144,878	L1465F	probably benign	Het
Map3k7	C	A	4: 31,988,592	T247N	probably damaging	Het
Mctp2	T	G	7: 72,259,349	Q72P	possibly damaging	Het
Miga1	T	C	3: 152,290,806	Y335C	probably benign	Het
Ms4a14	A	T	19: 11,314,277	N19K	probably benign	Het
Mylk	G	A	16: 34,894,925	R541Q	probably damaging	Het
Nav3	T	C	10: 109,823,552	T735A	probably benign	Het
Nlgn1	T	A	3: 25,436,030	H511L	probably damaging	Het
Nlrp4a	A	T	7: 26,450,808	E613D	probably benign	Het
Nuf2	A	G	1: 169,510,468	S247P	probably damaging	Het
Ocstamp	A	G	2: 165,398,182	V28A	probably benign	Het
Odf2	A	C	2: 29,902,240	E155D	possibly damaging	Het
Olfr285	T	C	15: 98,312,680	N290S	probably damaging	Het
Olfr695	G	A	7: 106,874,237	P3S	probably benign	Het
Otud7a	T	C	7: 63,729,910		probably null	Het
Pacsin2	A	T	15: 83,385,059	D11E	probably damaging	Het
Pcdhga5	G	A	18: 37,695,194	V232I	probably damaging	Het
Plcb3	A	G	19: 6,962,984	I439T	possibly damaging	Het
Rag1	A	G	2: 101,643,516	V427A	probably damaging	Het
Ranbp10	A	T	8: 105,826,125	C128*	probably null	Het
Rbm8a2	A	G	1: 175,978,458	V151A	probably damaging	Het
S100pbp	A	G	4: 129,150,933		probably benign	Het
Serpinb5	G	T	1: 106,872,339	L86F	probably damaging	Het
Sgo2b	T	C	8: 63,931,414	I183V	probably benign	Het
Slc25a25	A	T	2: 32,420,410	D112E	probably damaging	Het
Slc30a5	C	T	13: 100,813,710	V103I	probably damaging	Het
Slc9a2	A	T	1: 40,718,849	I183F	probably benign	Het
Srrm4	T	A	5: 116,475,190	K141N	unknown	Het
Tbc1d20	T	C	2: 152,311,989		probably benign	Het
Tep1	A	G	14: 50,841,302	L1498P	probably damaging	Het
Tgfbi	T	C	13: 56,632,120	M494T	probably benign	Het
Tox	A	G	4: 6,823,033	S95P	probably benign	Het
Tpr	G	A	1: 150,398,608	V163I	probably benign	Het
Ttn	A	G	2: 76,716,085	M32328T	probably damaging	Het
Vps39	A	T	2: 120,338,559	N289K	probably benign	Het
Xdh	C	T	17: 73,906,215	A847T	probably damaging	Het
Xndc1	G	A	7: 102,073,316	G63R	probably null	Het
Ythdc2	A	G	18: 44,885,240	S1330G	probably benign	Het
Zc3h14	C	G	12: 98,752,848	D157E	probably damaging	Het
Zc3h7b	A	T	15: 81,793,663	K949N	probably damaging	Het
Zp3r	A	T	1: 130,598,912	Y185N	probably damaging	Het

Other mutations in Trpm7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00232:Trpm7	APN	2	126829031	missense	possibly damaging	0.82
IGL01084:Trpm7	APN	2	126846072	critical splice donor site	probably null
IGL01634:Trpm7	APN	2	126826818	missense	probably damaging	1.00
IGL01678:Trpm7	APN	2	126816799	missense	probably damaging	0.99
IGL02005:Trpm7	APN	2	126813184	missense	probably damaging	0.97
IGL02064:Trpm7	APN	2	126797943	missense	probably damaging	1.00
IGL02156:Trpm7	APN	2	126799243	unclassified	probably benign
IGL02172:Trpm7	APN	2	126795328	missense	possibly damaging	0.94
IGL02334:Trpm7	APN	2	126807362	missense	probably benign
IGL02375:Trpm7	APN	2	126825744	missense	probably damaging	1.00
IGL02388:Trpm7	APN	2	126819891	missense	possibly damaging	0.80
IGL02552:Trpm7	APN	2	126840779	missense	probably damaging	1.00
IGL02684:Trpm7	APN	2	126846159	missense	probably damaging	0.99
IGL02901:Trpm7	APN	2	126807287	critical splice donor site	probably null
Accused	UTSW	2	126826737	missense	probably damaging	0.99
Condemned	UTSW	2	126835508	missense	probably damaging	1.00
P0037:Trpm7	UTSW	2	126816757	splice site	probably benign
R0038:Trpm7	UTSW	2	126795468	missense	probably damaging	1.00
R0139:Trpm7	UTSW	2	126812771	missense	probably benign
R0165:Trpm7	UTSW	2	126797513	missense	probably damaging	0.97
R0511:Trpm7	UTSW	2	126826718	nonsense	probably null
R0543:Trpm7	UTSW	2	126848529	missense	probably damaging	1.00
R0784:Trpm7	UTSW	2	126846072	critical splice donor site	probably null
R0844:Trpm7	UTSW	2	126835508	missense	probably damaging	1.00
R0865:Trpm7	UTSW	2	126799239	unclassified	probably null
R0919:Trpm7	UTSW	2	126831238	missense	probably damaging	1.00
R0972:Trpm7	UTSW	2	126805049	missense	probably benign
R1109:Trpm7	UTSW	2	126797793	missense	probably benign	0.01
R1118:Trpm7	UTSW	2	126822486	missense	possibly damaging	0.63
R1278:Trpm7	UTSW	2	126825454	nonsense	probably null
R1527:Trpm7	UTSW	2	126830162	missense	probably benign	0.18
R1542:Trpm7	UTSW	2	126822599	nonsense	probably null
R1882:Trpm7	UTSW	2	126812777	missense	probably benign	0.00
R1951:Trpm7	UTSW	2	126831299	missense	probably damaging	1.00
R2011:Trpm7	UTSW	2	126823997	nonsense	probably null
R2012:Trpm7	UTSW	2	126823997	nonsense	probably null
R2026:Trpm7	UTSW	2	126812738	missense	probably benign	0.39
R2067:Trpm7	UTSW	2	126797727	missense	probably damaging	1.00
R2926:Trpm7	UTSW	2	126858409	splice site	probably benign
R3082:Trpm7	UTSW	2	126844422	missense	possibly damaging	0.90
R3552:Trpm7	UTSW	2	126826710	splice site	probably benign
R3607:Trpm7	UTSW	2	126796428	intron	probably benign
R3739:Trpm7	UTSW	2	126851521	missense	probably damaging	1.00
R3943:Trpm7	UTSW	2	126831218	missense	possibly damaging	0.94
R4161:Trpm7	UTSW	2	126816831	missense	probably damaging	1.00
R4176:Trpm7	UTSW	2	126829163	missense	possibly damaging	0.83
R4392:Trpm7	UTSW	2	126848538	missense	probably damaging	1.00
R4392:Trpm7	UTSW	2	126795509	splice site	probably null
R4404:Trpm7	UTSW	2	126833715	missense	probably damaging	0.97
R4574:Trpm7	UTSW	2	126797211	missense	probably benign	0.01
R4714:Trpm7	UTSW	2	126840783	nonsense	probably null
R4807:Trpm7	UTSW	2	126831229	missense	probably benign	0.00
R4846:Trpm7	UTSW	2	126813185	missense	possibly damaging	0.63
R4972:Trpm7	UTSW	2	126824058	missense	probably damaging	1.00
R5097:Trpm7	UTSW	2	126796336	critical splice donor site	probably null
R5263:Trpm7	UTSW	2	126821217	missense	probably benign	0.34
R5361:Trpm7	UTSW	2	126829241	missense	possibly damaging	0.77
R5377:Trpm7	UTSW	2	126842855	critical splice donor site	probably null
R5574:Trpm7	UTSW	2	126813030	missense	probably benign
R5782:Trpm7	UTSW	2	126797714	missense	probably benign	0.04
R5840:Trpm7	UTSW	2	126822611	nonsense	probably null
R6044:Trpm7	UTSW	2	126814745	missense	probably damaging	1.00
R6178:Trpm7	UTSW	2	126837381	missense	probably damaging	1.00
R6196:Trpm7	UTSW	2	126825639	missense	possibly damaging	0.66
R6457:Trpm7	UTSW	2	126807294	missense	probably benign
R6530:Trpm7	UTSW	2	126812711	missense	probably damaging	1.00
R6764:Trpm7	UTSW	2	126844420	missense	possibly damaging	0.79
R6841:Trpm7	UTSW	2	126813021	missense	probably benign	0.00
R6868:Trpm7	UTSW	2	126837414	missense	probably damaging	1.00
R7250:Trpm7	UTSW	2	126826765	missense	possibly damaging	0.87
R7402:Trpm7	UTSW	2	126799206	missense	probably damaging	1.00
R7451:Trpm7	UTSW	2	126826737	missense	probably damaging	0.99
R7486:Trpm7	UTSW	2	126831195	critical splice donor site	probably null
R7509:Trpm7	UTSW	2	126849922	missense	probably damaging	1.00
R7586:Trpm7	UTSW	2	126810165	missense	probably benign
R7774:Trpm7	UTSW	2	126813238	missense	probably benign	0.09
R7793:Trpm7	UTSW	2	126824075	nonsense	probably null
R7812:Trpm7	UTSW	2	126799316	missense	probably damaging	1.00
R7900:Trpm7	UTSW	2	126797498	missense	probably benign	0.01
R7983:Trpm7	UTSW	2	126797498	missense	probably benign	0.01
R8034:Trpm7	UTSW	2	126846199	missense	probably damaging	0.98
X0026:Trpm7	UTSW	2	126829290	missense	probably benign
Z1088:Trpm7	UTSW	2	126797281	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGCACTGGTACCTTGCTAATTC -3'
(R):5'- GCACAGAACCATTAAATCATGTTGG -3'

Sequencing Primer
(F):5'- ACTGGTACCTTGCTAATTCTCTTTTC -3'
(R):5'- TCATGTTGGATTCAAGTGGAATTATC -3'

Posted On

2016-09-16