Incidental Mutation 'R4815:Chuk'
ID430207
Institutional Source Beutler Lab
Gene Symbol Chuk
Ensembl Gene ENSMUSG00000025199
Gene Nameconserved helix-loop-helix ubiquitous kinase
SynonymsChuk1, IKK 1, IKK alpha, IkappaB kinase alpha, IKKalpha, IKK-1, IKK-alpha, IKK[a], IKK1
MMRRC Submission 042433-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4815 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location44073335-44107480 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 44077247 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Stop codon at position 703 (G703*)
Ref Sequence ENSEMBL: ENSMUSP00000026217 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026217] [ENSMUST00000119591]
Predicted Effect probably null
Transcript: ENSMUST00000026217
AA Change: G703*
SMART Domains Protein: ENSMUSP00000026217
Gene: ENSMUSG00000025199
AA Change: G703*

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
Pfam:Pkinase_Tyr 15 254 3.5e-39 PFAM
Pfam:Pkinase 15 298 8.3e-55 PFAM
Blast:PHB 589 659 1e-38 BLAST
IKKbetaNEMObind 706 743 1.64e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119591
SMART Domains Protein: ENSMUSP00000113809
Gene: ENSMUSG00000025199

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
Pfam:Pkinase_Tyr 15 253 9.1e-38 PFAM
Pfam:Pkinase 15 298 8.5e-54 PFAM
Blast:PHB 589 659 8e-39 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123806
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134495
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144286
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147423
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149091
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.5%
Validation Efficiency 96% (76/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the serine/threonine protein kinase family. The encoded protein, a component of a cytokine-activated protein complex that is an inhibitor of the essential transcription factor NF-kappa-B complex, phosphorylates sites that trigger the degradation of the inhibitor via the ubiquination pathway, thereby activating the transcription factor. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations die neonataly and exhibit thickened, taut, adhesive skin that prevents appendages from protruding from the trunk, absence of whiskers, skeletal abnormalities, and closed esophagus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alpk2 A T 18: 65,349,955 N327K probably damaging Het
Ank2 T C 3: 126,936,761 T675A probably benign Het
Arap3 T C 18: 37,973,243 T1516A probably benign Het
Asb18 A T 1: 90,014,425 N51K probably damaging Het
BC003331 A G 1: 150,374,846 C294R probably damaging Het
C7 A G 15: 5,059,405 V18A probably benign Het
Caap1 A G 4: 94,501,260 V279A probably benign Het
Cacnb2 A G 2: 14,874,780 D21G probably damaging Het
Ccdc171 T C 4: 83,795,221 S1166P probably damaging Het
Chgb A T 2: 132,793,299 H387L probably benign Het
Chp2 G A 7: 122,220,900 R91Q probably damaging Het
Clmn T C 12: 104,785,566 D210G probably damaging Het
Cyp4f18 A G 8: 71,995,995 V270A possibly damaging Het
Dgcr2 A G 16: 17,858,619 probably benign Het
Diaph1 A T 18: 37,895,203 V411D unknown Het
Dkk2 C T 3: 132,173,785 A75V probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dnase2a T C 8: 84,909,877 V187A probably benign Het
Dusp19 A G 2: 80,630,945 M193V probably benign Het
Ear-ps2 G A 14: 44,047,060 noncoding transcript Het
Gm37596 C T 3: 93,692,286 V259M probably benign Het
Golgb1 A T 16: 36,913,115 Q908L possibly damaging Het
Hsp90aa1 T C 12: 110,695,226 M119V possibly damaging Het
Ice2 C T 9: 69,407,118 R50C probably damaging Het
Ifi208 A T 1: 173,682,837 E186V probably damaging Het
Ift122 A G 6: 115,881,556 K166E possibly damaging Het
Jcad T A 18: 4,675,223 L995Q possibly damaging Het
Kcnc4 A T 3: 107,458,266 C209S probably benign Het
Kmt2a G A 9: 44,821,256 probably benign Het
Lrriq1 T A 10: 103,144,878 L1465F probably benign Het
Map3k7 C A 4: 31,988,592 T247N probably damaging Het
Mctp2 T G 7: 72,259,349 Q72P possibly damaging Het
Miga1 T C 3: 152,290,806 Y335C probably benign Het
Ms4a14 A T 19: 11,314,277 N19K probably benign Het
Mylk G A 16: 34,894,925 R541Q probably damaging Het
Nav3 T C 10: 109,823,552 T735A probably benign Het
Nlgn1 T A 3: 25,436,030 H511L probably damaging Het
Nlrp4a A T 7: 26,450,808 E613D probably benign Het
Nuf2 A G 1: 169,510,468 S247P probably damaging Het
Ocstamp A G 2: 165,398,182 V28A probably benign Het
Odf2 A C 2: 29,902,240 E155D possibly damaging Het
Olfr285 T C 15: 98,312,680 N290S probably damaging Het
Olfr695 G A 7: 106,874,237 P3S probably benign Het
Otud7a T C 7: 63,729,910 probably null Het
Pacsin2 A T 15: 83,385,059 D11E probably damaging Het
Pcdhga5 G A 18: 37,695,194 V232I probably damaging Het
Plcb3 A G 19: 6,962,984 I439T possibly damaging Het
Rag1 A G 2: 101,643,516 V427A probably damaging Het
Ranbp10 A T 8: 105,826,125 C128* probably null Het
Rbm8a2 A G 1: 175,978,458 V151A probably damaging Het
S100pbp A G 4: 129,150,933 probably benign Het
Serpinb5 G T 1: 106,872,339 L86F probably damaging Het
Sgo2b T C 8: 63,931,414 I183V probably benign Het
Slc25a25 A T 2: 32,420,410 D112E probably damaging Het
Slc30a5 C T 13: 100,813,710 V103I probably damaging Het
Slc9a2 A T 1: 40,718,849 I183F probably benign Het
Srrm4 T A 5: 116,475,190 K141N unknown Het
Tbc1d20 T C 2: 152,311,989 probably benign Het
Tep1 A G 14: 50,841,302 L1498P probably damaging Het
Tgfbi T C 13: 56,632,120 M494T probably benign Het
Tox A G 4: 6,823,033 S95P probably benign Het
Tpr G A 1: 150,398,608 V163I probably benign Het
Trpm7 A G 2: 126,858,492 S2P probably damaging Het
Ttn A G 2: 76,716,085 M32328T probably damaging Het
Vps39 A T 2: 120,338,559 N289K probably benign Het
Xdh C T 17: 73,906,215 A847T probably damaging Het
Xndc1 G A 7: 102,073,316 G63R probably null Het
Ythdc2 A G 18: 44,885,240 S1330G probably benign Het
Zc3h14 C G 12: 98,752,848 D157E probably damaging Het
Zc3h7b A T 15: 81,793,663 K949N probably damaging Het
Zp3r A T 1: 130,598,912 Y185N probably damaging Het
Other mutations in Chuk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Chuk APN 19 44088023 missense possibly damaging 0.56
IGL00585:Chuk APN 19 44078312 missense probably damaging 0.99
IGL00662:Chuk APN 19 44097210 missense possibly damaging 0.64
IGL01419:Chuk APN 19 44096981 missense probably damaging 1.00
IGL01728:Chuk APN 19 44098646 missense possibly damaging 0.94
IGL01753:Chuk APN 19 44098576 splice site probably benign
PIT4362001:Chuk UTSW 19 44098583 critical splice donor site probably null
PIT4382001:Chuk UTSW 19 44098607 missense probably damaging 0.99
R0107:Chuk UTSW 19 44096919 missense probably damaging 1.00
R0107:Chuk UTSW 19 44096919 missense probably damaging 1.00
R0504:Chuk UTSW 19 44081938 splice site probably benign
R0731:Chuk UTSW 19 44103766 splice site probably benign
R0846:Chuk UTSW 19 44091028 missense probably damaging 1.00
R1433:Chuk UTSW 19 44078958 missense probably null 1.00
R1585:Chuk UTSW 19 44077373 missense possibly damaging 0.89
R2020:Chuk UTSW 19 44107343 missense possibly damaging 0.59
R2179:Chuk UTSW 19 44103721 missense possibly damaging 0.95
R2441:Chuk UTSW 19 44096921 missense probably damaging 1.00
R4125:Chuk UTSW 19 44100174 missense probably null 0.00
R4180:Chuk UTSW 19 44101840 missense probably benign 0.01
R4746:Chuk UTSW 19 44088771 missense possibly damaging 0.86
R4852:Chuk UTSW 19 44088758 missense possibly damaging 0.91
R5330:Chuk UTSW 19 44078955 missense probably damaging 1.00
R5331:Chuk UTSW 19 44078955 missense probably damaging 1.00
R5517:Chuk UTSW 19 44097533 critical splice acceptor site probably null
R5854:Chuk UTSW 19 44081957 missense probably benign 0.00
R6149:Chuk UTSW 19 44101831 missense probably damaging 1.00
R6161:Chuk UTSW 19 44082637 missense probably damaging 1.00
R6232:Chuk UTSW 19 44096992 missense probably benign 0.21
R6768:Chuk UTSW 19 44096951 missense probably damaging 0.96
R6865:Chuk UTSW 19 44086915 nonsense probably null
R7916:Chuk UTSW 19 44096981 missense probably damaging 1.00
R8038:Chuk UTSW 19 44078977 missense probably damaging 1.00
R8064:Chuk UTSW 19 44082676 missense probably damaging 1.00
R8187:Chuk UTSW 19 44091112 missense probably benign 0.05
R8272:Chuk UTSW 19 44103736 missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- CAGCGCTGCAAATCTGAGTTC -3'
(R):5'- GTGCTCGCCTGTAACTTATTG -3'

Sequencing Primer
(F):5'- TTTAATCCCAGCACTCGGGAG -3'
(R):5'- CTCGCCTGTAACTTATTGTGTGTG -3'
Posted On2016-09-16