Incidental Mutation 'R4804:Scnn1g'
ID430208
Institutional Source Beutler Lab
Gene Symbol Scnn1g
Ensembl Gene ENSMUSG00000000216
Gene Namesodium channel, nonvoltage-gated 1 gamma
SynonymsENaC gamma
MMRRC Submission 041998-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.564) question?
Stock #R4804 (G1)
Quality Score217
Status Validated
Chromosome7
Chromosomal Location121734479-121768475 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) AATCCTGCAGGTGA to AA at 121763080 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000000221 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000221]
Predicted Effect probably null
Transcript: ENSMUST00000000221
SMART Domains Protein: ENSMUSP00000000221
Gene: ENSMUSG00000000216

DomainStartEndE-ValueType
Pfam:ASC 32 558 6.4e-91 PFAM
low complexity region 618 631 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 99% (78/79)
MGI Phenotype FUNCTION: This gene encodes the gamma subunit of the epithelial sodium channel, a member of the amiloride-sensitive sodium channel family of proteins. This channel regulates sodium homeostasis and blood pressure, by controlling sodium transport in the kidney, colon and lung. Proteolytic processing of the encoded protein results in the release of an inhibitory peptide and channel activation. Homozygous knockout mice for this gene exhibit perinatal lethality, likely due to excess serum potassium. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous mutation of this gene results in partial lethality between 24-36 hours after birth. Newborns exhibit hyperkalemia, clear lung liquid more slowly, and show low urinary potassium and high urinary sodium concentrations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020D05Rik A T 19: 5,503,000 M251K possibly damaging Het
4930527J03Rik T C 1: 178,276,109 noncoding transcript Het
Akap2 T C 4: 57,854,688 S67P probably benign Het
Ap4e1 T C 2: 127,043,758 probably null Het
Apbb1ip T C 2: 22,823,598 probably null Het
Apol11b T A 15: 77,635,266 I205F probably damaging Het
Arl6ip1 A T 7: 118,129,552 probably null Het
Barx2 A G 9: 31,846,812 S277P unknown Het
BC035947 T G 1: 78,497,876 D673A probably damaging Het
Cacna2d1 A T 5: 16,359,208 I930F probably damaging Het
Cd226 T C 18: 89,207,168 V63A possibly damaging Het
Cdk8 A G 5: 146,296,399 K236E probably damaging Het
Cds1 T C 5: 101,821,523 L449P probably damaging Het
Celsr1 T C 15: 85,937,953 D1721G possibly damaging Het
Chtf18 T C 17: 25,719,257 D934G probably benign Het
Clk4 T A 11: 51,281,323 L271Q probably damaging Het
Cnnm1 C A 19: 43,491,575 T853N probably benign Het
Col26a1 A G 5: 136,836,725 V103A probably damaging Het
D5Ertd579e C T 5: 36,629,652 probably null Het
Ddx39 A G 8: 83,721,095 K190E probably damaging Het
Dgkg G A 16: 22,575,193 probably benign Het
Dnajc14 A T 10: 128,814,057 H477L probably benign Het
Dytn A G 1: 63,643,366 V374A probably benign Het
Gfra2 T C 14: 70,925,921 Y215H possibly damaging Het
Grik1 A G 16: 87,957,569 I376T probably damaging Het
Gzmm A T 10: 79,695,056 T231S probably benign Het
Hecw1 A G 13: 14,305,985 S499P probably benign Het
Hhla1 T C 15: 65,923,099 I511V probably benign Het
Ifnlr1 A G 4: 135,705,336 D361G possibly damaging Het
Ikzf3 A G 11: 98,490,574 V60A probably benign Het
Ipo4 G C 14: 55,630,856 R495G possibly damaging Het
Kat2b-ps A T 5: 93,392,533 noncoding transcript Het
Kdm1b C T 13: 47,063,077 R308W probably damaging Het
Mblac2 T A 13: 81,750,309 L268* probably null Het
Mipep C T 14: 60,802,952 T307I probably damaging Het
Ms4a14 A G 19: 11,304,040 S385P possibly damaging Het
Myh2 T A 11: 67,186,502 I821N possibly damaging Het
Myo5c A T 9: 75,245,024 I65F probably damaging Het
Neurog1 A G 13: 56,251,766 L56P probably benign Het
Nrsn1 C A 13: 25,253,597 C116F probably benign Het
Nynrin T C 14: 55,864,869 V665A probably benign Het
Olfr1369-ps1 T A 13: 21,116,005 Y104* probably null Het
Olfr1490 A G 19: 13,654,518 M30V probably benign Het
Olfr988 T C 2: 85,353,081 I282V probably benign Het
Pcdhac1 C T 18: 37,091,178 S348L possibly damaging Het
Pcnx4 T C 12: 72,574,202 I932T probably benign Het
Pfkl G A 10: 77,991,394 T486I probably benign Het
Pi4ka A T 16: 17,308,161 M1115K possibly damaging Het
Rilpl1 A G 5: 124,493,765 W173R probably damaging Het
Rnf111 A T 9: 70,430,957 C900S possibly damaging Het
Ryr2 A G 13: 11,717,097 V2319A probably damaging Het
Slc25a13 A T 6: 6,109,213 L383H probably damaging Het
Slco2a1 C T 9: 103,073,184 P325L probably damaging Het
Stoml2 T C 4: 43,029,882 N162S probably benign Het
Syne1 G T 10: 5,349,310 Q982K possibly damaging Het
Tbc1d31 C T 15: 57,951,106 Q568* probably null Het
Tbc1d9 G A 8: 83,255,925 probably null Het
Tbx3 A G 5: 119,680,512 D384G possibly damaging Het
Tecta T C 9: 42,398,237 I14V probably benign Het
Tgm1 A T 14: 55,705,619 V588E probably benign Het
Tpk1 A C 6: 43,593,078 probably benign Het
Tspear A T 10: 77,776,957 probably null Het
Ubxn10 G T 4: 138,721,204 Q54K possibly damaging Het
Ubxn4 C T 1: 128,266,404 R312* probably null Het
Vmn1r230 A T 17: 20,847,083 K178M probably damaging Het
Zfp143 G A 7: 110,088,769 V445I probably damaging Het
Zfp688 C A 7: 127,421,885 W40C probably damaging Het
Other mutations in Scnn1g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00819:Scnn1g APN 7 121740437 missense probably benign 0.00
IGL01824:Scnn1g APN 7 121766293 missense probably benign 0.00
IGL02133:Scnn1g APN 7 121743699 missense probably damaging 1.00
IGL02529:Scnn1g APN 7 121742446 splice site probably benign
IGL02814:Scnn1g APN 7 121740365 missense probably damaging 1.00
IGL03091:Scnn1g APN 7 121746683 missense probably damaging 1.00
IGL03253:Scnn1g APN 7 121737933 nonsense probably null
PIT4504001:Scnn1g UTSW 7 121742331 missense probably benign 0.30
R0230:Scnn1g UTSW 7 121746761 splice site probably benign
R0324:Scnn1g UTSW 7 121740555 missense possibly damaging 0.62
R0367:Scnn1g UTSW 7 121746579 splice site probably benign
R0534:Scnn1g UTSW 7 121767424 missense probably benign 0.00
R1747:Scnn1g UTSW 7 121760463 missense probably damaging 0.99
R2004:Scnn1g UTSW 7 121738188 nonsense probably null
R2197:Scnn1g UTSW 7 121767296 missense probably damaging 1.00
R4396:Scnn1g UTSW 7 121740427 missense probably benign 0.01
R4805:Scnn1g UTSW 7 121746602 missense probably damaging 1.00
R5219:Scnn1g UTSW 7 121766266 missense probably damaging 1.00
R5757:Scnn1g UTSW 7 121738215 missense probably damaging 1.00
R5882:Scnn1g UTSW 7 121767358 missense possibly damaging 0.79
R5910:Scnn1g UTSW 7 121738095 missense probably damaging 0.99
R6381:Scnn1g UTSW 7 121767499 missense probably benign 0.00
R6666:Scnn1g UTSW 7 121767388 missense probably benign 0.00
R6735:Scnn1g UTSW 7 121742263 missense probably benign 0.02
R6813:Scnn1g UTSW 7 121740353 missense probably damaging 1.00
R6860:Scnn1g UTSW 7 121740353 missense probably damaging 1.00
R6887:Scnn1g UTSW 7 121760444 missense probably benign 0.01
R7289:Scnn1g UTSW 7 121738081 nonsense probably null
R7488:Scnn1g UTSW 7 121763434 missense probably benign 0.00
R7630:Scnn1g UTSW 7 121760481 missense probably damaging 1.00
R7888:Scnn1g UTSW 7 121743655 missense probably damaging 0.97
Z1177:Scnn1g UTSW 7 121760475 missense probably benign
Predicted Primers PCR Primer
(F):5'- GACCCTCAGCATTTGTAAAAGG -3'
(R):5'- GACTAGCTGAGGACACCAAG -3'

Sequencing Primer
(F):5'- CCCTCAGCATTTGTAAAAGGTGTAC -3'
(R):5'- TGAGGACACCAAGGGCTC -3'
Posted On2016-09-16