Incidental Mutation 'R4826:Dusp4'
List |< first << previous [record 13 of 60] next >> last >|
ID430224
Institutional Source Beutler Lab
Gene Symbol Dusp4
Ensembl Gene ENSMUSG00000031530
Gene Namedual specificity phosphatase 4
SynonymsMKP2, E130306H24Rik, 2700078F24Rik
MMRRC Submission 042442-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.211) question?
Stock #R4826 (G1)
Quality Score69
Status Validated
Chromosome8
Chromosomal Location34807297-34819894 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 34818517 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 311 (F311I)
Ref Sequence ENSEMBL: ENSMUSP00000033930 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033930]
Predicted Effect probably damaging
Transcript: ENSMUST00000033930
AA Change: F311I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000033930
Gene: ENSMUSG00000031530
AA Change: F311I

DomainStartEndE-ValueType
RHOD 35 160 4.16e-15 SMART
DSPc 199 337 2.91e-64 SMART
Meta Mutation Damage Score 0.7760 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mitogen-activated protein (MAP) kinase superfamily (MAPK/ERK, SAPK/JNK, p38), which are associated with cellular proliferation and differentiation. Different members of the family of dual specificity phosphatases show distinct substrate specificities for various MAP kinases, different tissue distribution and subcellular localization, and different modes of inducibility of their expression by extracellular stimuli. This gene product inactivates ERK1, ERK2 and JNK, is expressed in a variety of tissues, and is localized in the nucleus. Two alternatively spliced transcript variants, encoding distinct isoforms, have been observed for this gene. In addition, multiple polyadenylation sites have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit a decrease in B cell apoptosis of bone marrow-derived, IL-7-dependent pro-B lymphocytes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik G T 18: 12,185,779 probably benign Het
Abca14 A T 7: 120,216,247 R239S probably damaging Het
Acin1 A G 14: 54,664,617 S573P probably damaging Het
Acta2 A T 19: 34,251,823 Y55* probably null Het
Aifm2 T C 10: 61,725,989 M38T probably benign Het
Ank2 C A 3: 126,956,001 V460L probably benign Het
Ap1b1 T C 11: 5,018,043 S185P probably benign Het
Arsj A G 3: 126,438,802 Y399C probably damaging Het
Clec2d T C 6: 129,184,159 V73A probably benign Het
Cntln T G 4: 85,005,044 M582R probably benign Het
Cyp4a10 C T 4: 115,518,344 P8L probably benign Het
Dip2b A G 15: 100,169,281 N555D probably damaging Het
Eif4g3 T C 4: 138,177,945 V1245A possibly damaging Het
Ephb3 G A 16: 21,214,995 R23H possibly damaging Het
Ext2 T C 2: 93,762,630 T410A probably benign Het
Fam193a A G 5: 34,436,531 E124G probably damaging Het
Fat4 T A 3: 38,982,957 V3586E probably damaging Het
Frmd4a T C 2: 4,601,297 S611P probably damaging Het
Gcn1l1 A G 5: 115,593,693 T956A probably benign Het
Gm10549 C A 18: 33,470,785 T107K unknown Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Herc6 T A 6: 57,647,087 M614K probably benign Het
Hspg2 T C 4: 137,565,395 C4095R probably damaging Het
Hyal5 T C 6: 24,891,576 I463T possibly damaging Het
Icam5 C T 9: 21,037,803 A817V possibly damaging Het
Igf2r A T 17: 12,701,353 D1366E probably damaging Het
Ints7 G A 1: 191,611,906 V553I probably damaging Het
Iqgap2 T A 13: 95,763,275 I92F probably damaging Het
Itgb1 T A 8: 128,720,308 C435S probably damaging Het
Lrrc71 T C 3: 87,743,308 M216V probably benign Het
Mgam T C 6: 40,680,648 V979A possibly damaging Het
Myh9 A T 15: 77,788,946 Y400* probably null Het
Narfl A G 17: 25,780,332 H240R probably damaging Het
Nbeal1 A G 1: 60,251,342 R1033G possibly damaging Het
Nit1 T C 1: 171,345,598 probably benign Het
Nlrp1c-ps A G 11: 71,242,517 noncoding transcript Het
Nt5c1a T C 4: 123,208,572 V97A probably damaging Het
Olfr1154 T A 2: 87,903,349 D109V probably damaging Het
Olfr358 A G 2: 37,005,333 Y94H probably damaging Het
Olfr43 A G 11: 74,206,331 M295T possibly damaging Het
Olfr46 T A 7: 140,610,319 M51K probably benign Het
Olfr683 G T 7: 105,143,968 N108K probably damaging Het
Pde4a T A 9: 21,192,380 probably null Het
Pkn2 T C 3: 142,809,509 K640R probably damaging Het
Pla2g6 A G 15: 79,308,679 S263P possibly damaging Het
Prkg1 A G 19: 31,764,606 S73P possibly damaging Het
Prr27 A C 5: 87,850,966 probably benign Het
Rad54b G T 4: 11,599,753 W319L probably damaging Het
Rassf8 T A 6: 145,816,550 L349H probably damaging Het
Rnf113a2 T A 12: 84,417,614 N93K probably benign Het
Sapcd2 C T 2: 25,372,756 A109V probably benign Het
Slamf9 C A 1: 172,476,441 H118N probably benign Het
Slc37a1 A G 17: 31,322,173 Y213C probably damaging Het
Slc5a1 A G 5: 33,159,150 D580G probably benign Het
Slc7a2 T A 8: 40,911,046 I432N probably damaging Het
Tas2r114 A T 6: 131,689,837 L76Q probably damaging Het
Tcerg1 C T 18: 42,535,115 P391L unknown Het
Tdrd12 A C 7: 35,504,157 V314G probably benign Het
Zbtb7b A G 3: 89,380,773 L246S probably benign Het
Other mutations in Dusp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01025:Dusp4 APN 8 34818512 missense probably benign 0.35
IGL02948:Dusp4 APN 8 34818572 missense probably damaging 1.00
R1537:Dusp4 UTSW 8 34818416 missense probably benign 0.00
R1644:Dusp4 UTSW 8 34818479 missense probably damaging 1.00
R4492:Dusp4 UTSW 8 34807736 missense possibly damaging 0.56
R5396:Dusp4 UTSW 8 34817304 missense probably damaging 1.00
R5637:Dusp4 UTSW 8 34817297 missense probably damaging 1.00
R6850:Dusp4 UTSW 8 34816497 nonsense probably null
R7078:Dusp4 UTSW 8 34807911 missense probably damaging 0.99
R8346:Dusp4 UTSW 8 34807938 missense possibly damaging 0.91
RF012:Dusp4 UTSW 8 34807799 small deletion probably benign
Z1177:Dusp4 UTSW 8 34808090 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- TAGTGGCGAATCCCTGAAGC -3'
(R):5'- CAGAGACGAGTCCTAACAGC -3'

Sequencing Primer
(F):5'- TGAAGCCCGCCAAGGTC -3'
(R):5'- ACGAGTCCTAACAGCTGGGG -3'
Posted On2016-09-21