Incidental Mutation 'R4830:Grhl2'
ID430241
Institutional Source Beutler Lab
Gene Symbol Grhl2
Ensembl Gene ENSMUSG00000022286
Gene Namegrainyhead like transcription factor 2
SynonymsBOM, Tcfcp2l3, grainyheadlike, 0610015A08Rik
MMRRC Submission 042446-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4830 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location37233036-37363569 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to A at 37335659 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000022895] [ENSMUST00000161405]
Predicted Effect probably benign
Transcript: ENSMUST00000022895
SMART Domains Protein: ENSMUSP00000022895
Gene: ENSMUSG00000022286

DomainStartEndE-ValueType
Pfam:CP2 214 438 8.5e-88 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000159221
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159341
Predicted Effect probably benign
Transcript: ENSMUST00000161405
SMART Domains Protein: ENSMUSP00000125410
Gene: ENSMUSG00000022286

DomainStartEndE-ValueType
Pfam:CP2 209 434 2.1e-79 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161933
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency 97% (71/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transcription factor that can act as a homodimer or as a heterodimer with either GRHL1 or GRHL3. Defects in this gene are a cause of non-syndromic sensorineural deafness autosomal dominant type 28 (DFNA28).[provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality during organogenesis with cranioschisis, facial cleft, impaired neural fold elevation, and an open posterior neuropore. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd3 C A 3: 121,760,284 G643V probably damaging Het
Adamtsl1 A G 4: 86,356,382 E1225G probably damaging Het
Agbl5 G A 5: 30,890,715 R111H probably damaging Het
Ankle2 A C 5: 110,242,013 K446Q probably damaging Het
Boc A C 16: 44,490,157 M800R probably damaging Het
Ccnt1 A T 15: 98,543,451 N645K probably damaging Het
Cd93 G A 2: 148,443,379 Q16* probably null Het
Cpsf4l G T 11: 113,709,502 probably benign Het
Cuzd1 T A 7: 131,318,054 D111V probably damaging Het
Dab2 T C 15: 6,427,527 C232R probably benign Het
Dmpk A T 7: 19,087,528 Y237F probably damaging Het
Dnah6 T A 6: 73,044,762 T3526S possibly damaging Het
Dock2 T C 11: 34,273,767 probably null Het
Dsp G A 13: 38,192,864 V1542I probably benign Het
Dst T A 1: 34,198,505 probably null Het
Esd T C 14: 74,741,160 L54S probably damaging Het
Exd1 C T 2: 119,520,326 A485T probably benign Het
Gm3604 A T 13: 62,369,043 N500K probably damaging Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gsto1 C T 19: 47,864,391 R222C probably benign Het
H2afy2 C T 10: 61,739,353 D355N possibly damaging Het
Inpp4a T A 1: 37,371,780 M343K probably damaging Het
Itpripl2 T C 7: 118,491,057 Q93R probably benign Het
Jakmip2 G A 18: 43,567,143 T450I probably benign Het
Kdm6b A T 11: 69,403,794 I1186N unknown Het
Kif1a T C 1: 93,021,209 probably null Het
Klhl20 T C 1: 161,098,376 K434R probably benign Het
Lemd3 T C 10: 120,931,948 D697G probably damaging Het
Lipo1 A G 19: 33,776,587 S383P probably damaging Het
Ltn1 C A 16: 87,379,694 K1741N probably damaging Het
Lvrn A T 18: 46,905,351 T991S probably damaging Het
Mast3 C A 8: 70,788,915 R151L possibly damaging Het
Muc4 G C 16: 32,753,919 R1265P probably benign Het
Myoz1 T C 14: 20,655,309 K14E probably damaging Het
Neb G T 2: 52,192,520 Q5450K probably damaging Het
Nedd1 T A 10: 92,686,258 N639I probably damaging Het
Nlrp4e A T 7: 23,336,740 N673Y probably benign Het
Nop53 C T 7: 15,942,204 R190Q probably damaging Het
Notch4 T C 17: 34,570,118 Y468H probably damaging Het
Obscn T C 11: 59,067,607 T3507A probably damaging Het
Olfr724 T C 14: 49,960,224 N283D probably damaging Het
Opn5 T C 17: 42,611,296 H5R probably benign Het
Patl1 T C 19: 11,925,151 M349T probably benign Het
Phactr3 A G 2: 178,284,018 N362S probably damaging Het
Pirb C T 7: 3,717,603 G299S probably benign Het
Rapgef5 G A 12: 117,756,074 R579Q probably damaging Het
Rgl1 T C 1: 152,554,330 D234G probably benign Het
Serpinb3a C T 1: 107,048,586 E122K probably benign Het
Slc22a15 T C 3: 101,875,603 probably benign Het
Slc25a12 A T 2: 71,296,805 V344E probably damaging Het
Slc43a2 T C 11: 75,543,293 L99P probably damaging Het
Smim27 G T 4: 40,269,719 probably null Het
Smtn A G 11: 3,520,736 probably benign Het
Szt2 A T 4: 118,369,248 Y3001N unknown Het
Tgfbr3 G T 5: 107,109,719 P825T probably damaging Het
Tnpo3 T C 6: 29,568,938 T472A probably benign Het
Trf T A 9: 103,227,915 D66V probably damaging Het
Vmn1r124 A G 7: 21,259,699 C307R probably damaging Het
Vps13b T A 15: 35,452,224 F656Y possibly damaging Het
Zic1 G T 9: 91,362,531 S358R probably damaging Het
Other mutations in Grhl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00766:Grhl2 APN 15 37336301 missense probably damaging 1.00
IGL01730:Grhl2 APN 15 37337774 missense probably benign 0.00
IGL02140:Grhl2 APN 15 37270586 splice site probably benign
IGL02307:Grhl2 APN 15 37288288 missense probably damaging 1.00
IGL02375:Grhl2 APN 15 37291577 missense probably damaging 1.00
IGL02508:Grhl2 APN 15 37309765 splice site probably benign
clayton UTSW 15 37291676 splice site probably null
R0462:Grhl2 UTSW 15 37344675 missense probably benign 0.00
R1421:Grhl2 UTSW 15 37309716 missense probably damaging 1.00
R1548:Grhl2 UTSW 15 37336323 missense probably benign 0.32
R1912:Grhl2 UTSW 15 37358407 missense probably damaging 1.00
R1960:Grhl2 UTSW 15 37336314 missense probably damaging 1.00
R3110:Grhl2 UTSW 15 37336347 critical splice donor site probably null
R3112:Grhl2 UTSW 15 37336347 critical splice donor site probably null
R4261:Grhl2 UTSW 15 37360823 missense possibly damaging 0.64
R4910:Grhl2 UTSW 15 37291676 splice site probably null
R4929:Grhl2 UTSW 15 37360802 missense probably benign
R4952:Grhl2 UTSW 15 37287249 missense probably benign 0.13
R5742:Grhl2 UTSW 15 37328372 missense probably damaging 1.00
R7142:Grhl2 UTSW 15 37279582 missense probably benign 0.05
R7208:Grhl2 UTSW 15 37335736 missense probably damaging 1.00
R7466:Grhl2 UTSW 15 37291616 missense probably damaging 1.00
R7519:Grhl2 UTSW 15 37336312 missense probably damaging 1.00
R7538:Grhl2 UTSW 15 37328359 missense probably damaging 1.00
R7637:Grhl2 UTSW 15 37328330 missense probably damaging 0.96
R8027:Grhl2 UTSW 15 37279483 missense probably benign
R8047:Grhl2 UTSW 15 37336221 missense probably benign 0.00
Z1177:Grhl2 UTSW 15 37333287 missense unknown
Predicted Primers PCR Primer
(F):5'- ATCGCTCCAAGGTCAAAGCG -3'
(R):5'- CCCACTTAGCACAGTATGGG -3'

Sequencing Primer
(F):5'- ACCTTCATGGCATGTGAGC -3'
(R):5'- CACTTAGCACAGTATGGGGGAGG -3'
Posted On2016-09-28