Incidental Mutation 'R4889:Asmt'
ID430247
Institutional Source Beutler Lab
Gene Symbol Asmt
Ensembl Gene ENSMUSG00000093806
Gene Nameacetylserotonin O-methyltransferase
SynonymsHiomt
MMRRC Submission 042494-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock #R4889 (G1)
Quality Score28
Status Validated
ChromosomeX
Chromosomal Location170672644-170678054 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 170677029 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 250 (R250L)
Ref Sequence ENSEMBL: ENSMUSP00000137135 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000178693]
Predicted Effect possibly damaging
Transcript: ENSMUST00000178693
AA Change: R250L

PolyPhen 2 Score 0.841 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000137135
Gene: ENSMUSG00000093806
AA Change: R250L

DomainStartEndE-ValueType
Pfam:Dimerisation2 17 106 1.1e-29 PFAM
Pfam:Methyltransf_2 111 343 2.8e-82 PFAM
Pfam:Methyltransf_11 190 292 2.8e-8 PFAM
low complexity region 351 371 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: This gene belongs to the methyltransferase superfamily and is located in the pseudoautosomal region (PAR) of the X and Y chromosomes. The encoded enzyme catalyzes the final reaction in the synthesis of melatonin and is abundant in the pineal gland. Two amino acid substitutions (R78G and R242C) are present in the encoded protein derived from the reference strain, C57BL/6J, and this protein shows low enzyme activity relative to the protein derived from other strains. [provided by RefSeq, May 2015]
PHENOTYPE: Pineal melatonin synthesis requires enzymes encoded by Asmt and Aanat. C57BL/6, BALB/c, AKR/J, NZB/Bl, IS/Cam, and CAST/Ei carry the a allele of Asmt and lack melatonin. SK/Cam, SF/Cam, PERU, and FDS carry the b allele and have normal melatonin levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ado G C 10: 67,548,305 R157G probably benign Het
Akap12 C A 10: 4,356,535 A1115E probably damaging Het
Ankhd1 A G 18: 36,578,734 M196V probably null Het
Appl2 G A 10: 83,641,058 T34I probably damaging Het
Arhgap21 T C 2: 20,880,468 S472G probably benign Het
Baz2b A T 2: 59,936,726 I870N probably damaging Het
Card11 T C 5: 140,885,945 Q667R possibly damaging Het
Cercam A G 2: 29,881,833 D555G probably damaging Het
Cop1 A T 1: 159,284,589 R284S probably damaging Het
Cr2 A G 1: 195,176,585 V9A possibly damaging Het
Ctsm A G 13: 61,538,401 F106S probably damaging Het
Dhx9 A T 1: 153,481,149 L118Q probably damaging Het
Dnah5 G T 15: 28,235,792 C355F probably benign Het
Dock1 C A 7: 134,744,976 N212K probably benign Het
Efemp2 T A 19: 5,475,120 L18Q probably null Het
Flvcr1 A G 1: 191,025,567 L176P probably damaging Het
Gm16505 A T 13: 3,361,125 noncoding transcript Het
Gm6457 A T 18: 14,570,444 noncoding transcript Het
Gnptab A G 10: 88,433,913 N826S probably benign Het
Hdc T G 2: 126,594,133 N606T probably benign Het
Itga3 T C 11: 95,068,301 D113G probably benign Het
Maml3 C T 3: 51,694,510 probably benign Het
Mkrn1 A T 6: 39,420,005 probably benign Het
Myo18a T C 11: 77,832,412 V720A probably damaging Het
Nkx3-1 G A 14: 69,190,998 probably null Het
Npat T C 9: 53,562,207 I433T probably benign Het
Ofcc1 G A 13: 40,015,388 T841I probably damaging Het
Olfr1024 C T 2: 85,904,748 C102Y possibly damaging Het
Olfr1115 A T 2: 87,252,647 I237F probably damaging Het
Olfr365 A G 2: 37,202,045 Y268C probably damaging Het
Pde6c T A 19: 38,133,151 M69K probably benign Het
Pde7b T C 10: 20,548,077 T18A probably benign Het
Plcz1 T C 6: 140,007,748 K381R probably benign Het
Ppfia4 A C 1: 134,300,514 F1095V probably damaging Het
Sfxn3 T C 19: 45,049,815 F78S probably damaging Het
Sim1 A T 10: 50,981,324 Y390F probably benign Het
Slc25a31 A G 3: 40,721,545 I174V probably benign Het
Slc5a9 C A 4: 111,891,744 probably null Het
Slco1b2 T G 6: 141,656,743 probably benign Het
Smarca5 C A 8: 80,704,697 D964Y possibly damaging Het
Sptbn2 T A 19: 4,729,430 S338R possibly damaging Het
Srcap T C 7: 127,538,547 V1023A possibly damaging Het
Syt16 A G 12: 74,129,495 E46G probably damaging Het
Tas2r114 A T 6: 131,689,795 I90K probably damaging Het
Tlx1 G T 19: 45,150,979 D22Y probably damaging Het
Vamp8 G A 6: 72,385,539 L93F possibly damaging Het
Vill T C 9: 119,063,341 S347P possibly damaging Het
Zfp974 A G 7: 27,910,819 Y494H possibly damaging Het
Other mutations in Asmt
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1634:Asmt UTSW X 170675829 missense probably damaging 1.00
R1809:Asmt UTSW X 170675745 splice site probably benign
R1994:Asmt UTSW X 170675789 missense possibly damaging 0.83
R4454:Asmt UTSW X 170672721 missense probably benign 0.01
R4546:Asmt UTSW X 170676495 critical splice donor site probably null
R4567:Asmt UTSW X 170676526 intron probably null
R5601:Asmt UTSW X 170676392 missense probably damaging 0.98
R5687:Asmt UTSW X 170678016 missense unknown
R6145:Asmt UTSW X 170674663 missense probably damaging 0.96
R6151:Asmt UTSW X 170676467 missense possibly damaging 0.92
R6582:Asmt UTSW X 170675031 critical splice donor site probably null
R6752:Asmt UTSW X 170676361 missense probably benign 0.02
R7737:Asmt UTSW X 170676440 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CATGCAAATTACACGCGGG -3'
(R):5'- ATGACCCCAGTGACCTCATC -3'

Sequencing Primer
(F):5'- GCGTGTATGCAAATGAGG -3'
(R):5'- AGTGACCTCATCTGGGCC -3'
Posted On2016-09-29