Incidental Mutation 'R4861:Frmd6'
ID430253
Institutional Source Beutler Lab
Gene Symbol Frmd6
Ensembl Gene ENSMUSG00000048285
Gene NameFERM domain containing 6
Synonyms
MMRRC Submission 042472-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4861 (G1)
Quality Score79
Status Validated
Chromosome12
Chromosomal Location70825514-70902234 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 70893726 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 382 (S382A)
Ref Sequence ENSEMBL: ENSMUSP00000052202 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057859]
Predicted Effect probably damaging
Transcript: ENSMUST00000057859
AA Change: S382A

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000052202
Gene: ENSMUSG00000048285
AA Change: S382A

DomainStartEndE-ValueType
B41 13 234 2.41e-25 SMART
FERM_C 241 332 9.63e-19 SMART
low complexity region 365 375 N/A INTRINSIC
low complexity region 382 395 N/A INTRINSIC
low complexity region 425 442 N/A INTRINSIC
low complexity region 506 512 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220515
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222045
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222802
Meta Mutation Damage Score 0.094 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.2%
  • 20x: 84.7%
Validation Efficiency 100% (53/53)
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 C T 2: 69,245,905 R1153H probably damaging Het
Ahcy T C 2: 155,060,516 E411G probably benign Het
Alpi T A 1: 87,100,469 I211F probably damaging Het
Arfgef3 G A 10: 18,607,731 A1415V probably benign Het
Car3 T C 3: 14,866,896 V109A probably damaging Het
Ccdc114 A G 7: 45,942,873 E359G probably damaging Het
Cdk13 A T 13: 17,766,586 V17D probably damaging Het
Cept1 A C 3: 106,505,732 S226A probably damaging Het
Dbt A T 3: 116,548,078 I443L probably benign Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Farp2 T C 1: 93,605,419 L633S probably damaging Het
Gm26727 T C 2: 67,432,945 I79M probably damaging Het
Gm5800 T A 14: 51,716,047 N37I probably damaging Het
Hapln1 G A 13: 89,601,452 G39S possibly damaging Het
Ice2 T A 9: 69,415,448 S408R probably benign Het
Lctl T C 9: 64,119,763 I131T possibly damaging Het
Mvk C T 5: 114,460,197 probably benign Het
Mzt1 T C 14: 99,047,474 probably null Het
Ncoa7 T A 10: 30,704,612 M117L probably benign Het
Npy4r C T 14: 34,146,883 W149* probably null Het
Nr5a2 A G 1: 136,948,720 probably null Het
Plg G A 17: 12,395,735 E301K probably benign Het
Pnkp C T 7: 44,862,403 S113L probably damaging Het
Rapgef2 T C 3: 79,074,436 K1084R probably benign Het
Slc41a2 T C 10: 83,316,458 Q51R probably damaging Het
Slc47a2 A T 11: 61,336,233 C170S probably benign Het
Slco1b2 A T 6: 141,671,222 N427I possibly damaging Het
Smc2 G A 4: 52,461,090 R571H probably benign Het
Sp4 G T 12: 118,300,811 probably null Het
Tas2r117 T C 6: 132,803,129 F77L probably benign Het
Tbcd C T 11: 121,601,961 R875C probably damaging Het
Thumpd2 A G 17: 81,026,801 S453P probably benign Het
Vars2 G T 17: 35,661,933 Q13K probably benign Het
Other mutations in Frmd6
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0629:Frmd6 UTSW 12 70883762 missense probably damaging 1.00
R0662:Frmd6 UTSW 12 70899444 nonsense probably null
R0747:Frmd6 UTSW 12 70864056 missense probably benign
R1144:Frmd6 UTSW 12 70877168 missense probably damaging 1.00
R1366:Frmd6 UTSW 12 70887889 splice site probably benign
R1763:Frmd6 UTSW 12 70893622 missense possibly damaging 0.90
R2135:Frmd6 UTSW 12 70894997 missense probably benign 0.00
R2342:Frmd6 UTSW 12 70883818 nonsense probably null
R3963:Frmd6 UTSW 12 70893864 missense probably benign 0.00
R3982:Frmd6 UTSW 12 70887834 missense probably damaging 1.00
R4010:Frmd6 UTSW 12 70899553 missense probably benign
R4416:Frmd6 UTSW 12 70877249 missense probably benign 0.04
R4823:Frmd6 UTSW 12 70872575 missense probably benign 0.22
R5368:Frmd6 UTSW 12 70864100 nonsense probably null
R5806:Frmd6 UTSW 12 70890020 missense probably damaging 1.00
R6226:Frmd6 UTSW 12 70863911 start gained probably benign
R6253:Frmd6 UTSW 12 70877213 missense probably damaging 0.99
R6781:Frmd6 UTSW 12 70899643 missense possibly damaging 0.68
R7051:Frmd6 UTSW 12 70897396 missense possibly damaging 0.78
R7156:Frmd6 UTSW 12 70877209 missense probably damaging 1.00
R7481:Frmd6 UTSW 12 70887055 missense probably damaging 1.00
U24488:Frmd6 UTSW 12 70893879 missense probably damaging 0.97
X0022:Frmd6 UTSW 12 70864108 missense probably damaging 1.00
Z1088:Frmd6 UTSW 12 70880678 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CCTTGATCTCAGCCTGACAC -3'
(R):5'- ATCTTGCGAGTCCTCTTCCAGG -3'

Sequencing Primer
(F):5'- GATCTCAGCCTGACACCGTCC -3'
(R):5'- AGTCCTCTTCCAGGCGGTC -3'
Posted On2016-10-03