Incidental Mutation 'R4854:Traf4'
ID 430260
Institutional Source Beutler Lab
Gene Symbol Traf4
Ensembl Gene ENSMUSG00000017386
Gene Name TNF receptor associated factor 4
Synonyms CART1, A530032M13Rik, msp2
MMRRC Submission 042465-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.937) question?
Stock # R4854 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 78158499-78165589 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) G to A at 78161520 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Stop codon at position 100 (Q100*)
Ref Sequence ENSEMBL: ENSMUSP00000017530 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017530] [ENSMUST00000017549] [ENSMUST00000073705] [ENSMUST00000155571]
AlphaFold Q61382
Predicted Effect probably null
Transcript: ENSMUST00000017530
AA Change: Q100*
SMART Domains Protein: ENSMUSP00000017530
Gene: ENSMUSG00000017386
AA Change: Q100*

DomainStartEndE-ValueType
RING 18 57 1.41e-4 SMART
Pfam:zf-TRAF 102 156 3.4e-19 PFAM
Pfam:zf-TRAF 156 210 4e-12 PFAM
Pfam:zf-TRAF 210 269 4.2e-23 PFAM
low complexity region 287 302 N/A INTRINSIC
MATH 312 445 1.04e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000017549
SMART Domains Protein: ENSMUSP00000017549
Gene: ENSMUSG00000017405

DomainStartEndE-ValueType
S_TKc 4 258 1.59e-81 SMART
low complexity region 288 316 N/A INTRINSIC
low complexity region 364 378 N/A INTRINSIC
Pfam:RCC1 415 464 4.1e-12 PFAM
Pfam:RCC1_2 451 480 9.2e-10 PFAM
Pfam:RCC1 467 516 9.9e-16 PFAM
Pfam:RCC1 585 634 4.4e-15 PFAM
Pfam:RCC1 637 687 2e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000073705
SMART Domains Protein: ENSMUSP00000073384
Gene: ENSMUSG00000037750

DomainStartEndE-ValueType
Pfam:FAM222A 27 562 5.6e-233 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125528
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148218
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149437
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152611
Predicted Effect probably benign
Transcript: ENSMUST00000155571
SMART Domains Protein: ENSMUSP00000121832
Gene: ENSMUSG00000037750

DomainStartEndE-ValueType
Pfam:FAM222A 27 562 3.2e-259 PFAM
Meta Mutation Damage Score 0.9754 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 98% (103/105)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the TNF receptor associated factor (TRAF) family. TRAF proteins are associated with, and mediate signal transduction from members of the TNF receptor superfamily. The encoded protein has been shown to interact with neurotrophin receptor, p75 (NTR/NTSR1), and negatively regulate NTR induced cell death and NF-kappa B activation. This protein has been found to bind to p47phox, a cytosolic regulatory factor included in a multi-protein complex known as NAD(P)H oxidase. This protein thus, is thought to be involved in the oxidative activation of MAPK8/JNK. Alternatively spliced transcript variants have been observed but the full-length nature of only one has been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations show respiratory problems, various skeletal defects, spina bifida and partial lethality around embryonic day 14. Homozygotes for an ENU-induced mutation exhibit postnatal lethality and hypopigmentation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810064F22Rik T A 9: 22,208,037 noncoding transcript Het
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Abl1 T C 2: 31,779,010 Y110H probably damaging Het
Ablim2 C T 5: 35,802,422 R73C possibly damaging Het
Agbl3 G A 6: 34,785,284 R73Q probably damaging Het
Agl C T 3: 116,778,618 probably null Het
Amotl1 G A 9: 14,593,451 Q191* probably null Het
Apbb1ip A G 2: 22,853,202 K349E possibly damaging Het
Arhgap10 G A 8: 77,420,089 Q229* probably null Het
Aspm C T 1: 139,478,072 Q1566* probably null Het
B3gnt3 G A 8: 71,692,873 R284C probably damaging Het
Brd4 A G 17: 32,220,237 V423A probably damaging Het
Btbd9 A T 17: 30,524,865 I221N probably damaging Het
Camp A G 9: 109,847,451 V168A probably benign Het
Cd1d2 T A 3: 86,989,249 probably null Het
Cdkn2d A T 9: 21,290,927 V8D probably benign Het
Clec4g T C 8: 3,716,534 N256D probably damaging Het
Clspn A G 4: 126,575,950 I771V probably benign Het
Cntn6 A G 6: 104,859,475 E862G possibly damaging Het
Col6a5 T C 9: 105,898,751 T1702A probably benign Het
Dnah7a T C 1: 53,706,729 probably benign Het
Dubr T C 16: 50,732,523 noncoding transcript Het
Dusp26 G A 8: 31,094,137 V91M probably damaging Het
Edc4 A T 8: 105,887,925 probably benign Het
F5 C T 1: 164,192,146 A730V probably damaging Het
Foxf1 A G 8: 121,086,814 T358A probably benign Het
Frem1 A T 4: 82,916,758 N1810K possibly damaging Het
Galc A T 12: 98,256,877 F87I probably damaging Het
Gars A G 6: 55,046,418 D66G probably damaging Het
Gbp11 G A 5: 105,325,508 L460F probably damaging Het
Gdf7 T C 12: 8,298,014 I436V probably damaging Het
Gigyf2 C T 1: 87,354,413 probably benign Het
Gm12239 T C 11: 56,015,953 noncoding transcript Het
Gm5592 A C 7: 41,217,471 probably benign Het
Gp2 A T 7: 119,452,199 D264E possibly damaging Het
Gphn G A 12: 78,627,210 V526M probably damaging Het
Grid1 A G 14: 35,321,641 I318V probably benign Het
Grm2 C A 9: 106,654,132 V53F possibly damaging Het
Gtpbp1 T C 15: 79,719,205 S632P probably benign Het
H2-M1 A G 17: 36,670,058 F329L probably benign Het
Hecw1 T A 13: 14,316,892 D92V probably benign Het
Hgh1 T C 15: 76,369,182 L76P probably damaging Het
Idi2 C A 13: 8,957,843 N63K probably benign Het
Ift122 A G 6: 115,862,746 T25A possibly damaging Het
Itgb2l A T 16: 96,426,117 C575* probably null Het
Jup A G 11: 100,383,041 S225P possibly damaging Het
Kcng3 A T 17: 83,588,306 C244S probably damaging Het
Klhl2 T A 8: 64,834,459 M46L possibly damaging Het
Ksr1 A T 11: 79,027,702 I460N probably damaging Het
Lama3 T A 18: 12,411,542 F314Y probably benign Het
Lbp T C 2: 158,327,518 V421A possibly damaging Het
Lcp1 G A 14: 75,200,489 G113D probably damaging Het
Lrp1b A T 2: 41,111,077 L2045H probably damaging Het
Mbd2 G T 18: 70,568,735 D107Y unknown Het
Ms4a14 C T 19: 11,310,369 V96I possibly damaging Het
N4bp2l2 C T 5: 150,662,051 E155K probably benign Het
Nbeal2 T G 9: 110,631,396 H1790P probably damaging Het
Nsg2 G A 11: 32,031,806 G84R probably benign Het
Odf3 A G 7: 140,849,462 Y168C probably damaging Het
Olfr1145 A G 2: 87,810,590 T257A probably damaging Het
Olfr286 A C 15: 98,227,544 F34V possibly damaging Het
P2rx2 T C 5: 110,340,927 N224D probably damaging Het
P2rx5 A T 11: 73,171,779 E438V probably benign Het
Paip1 C A 13: 119,449,889 probably benign Het
Pik3c2g T A 6: 139,768,779 V219E probably damaging Het
Ppp1r12b T C 1: 134,873,951 E509G probably damaging Het
Ppp1r15a T C 7: 45,525,373 S4G probably benign Het
Ppp5c T C 7: 17,009,022 S224G probably benign Het
Prr30 T G 14: 101,198,443 I228L probably benign Het
Purg A G 8: 33,387,314 I327V possibly damaging Het
Ralb T C 1: 119,475,915 T161A probably benign Het
Ripor3 T C 2: 167,992,813 R253G probably benign Het
Scgb2b6 T C 7: 31,617,832 noncoding transcript Het
Setd5 G T 6: 113,151,399 G1438W probably damaging Het
Sh3rf3 T A 10: 58,813,723 L50Q possibly damaging Het
Sipa1l2 G T 8: 125,473,601 T662K probably damaging Het
Skint5 A G 4: 113,580,528 L1021S unknown Het
Slc22a23 T C 13: 34,203,941 S391G probably benign Het
Slc4a5 G A 6: 83,271,017 V402I probably benign Het
Slco4c1 G A 1: 96,841,228 P303L probably damaging Het
Spink5 A T 18: 44,020,841 *1018C probably null Het
Stag3 T A 5: 138,296,694 probably null Het
Tmem117 T C 15: 95,094,688 F410L probably damaging Het
Tmod1 A G 4: 46,090,920 K158E possibly damaging Het
Tpsb2 GGCTGCTGCTGCTGCTG GGCTGCTGCTGCTG 17: 25,366,562 probably benign Het
Trpc4 A G 3: 54,302,218 Y668C probably damaging Het
Ttn T A 2: 76,767,583 N11335I possibly damaging Het
Uhrf1bp1l T G 10: 89,794,484 V382G probably damaging Het
Usp39 A T 6: 72,325,682 V463E probably benign Het
Vmn1r6 A C 6: 57,002,698 Y115S probably benign Het
Vmn2r44 A G 7: 8,380,301 I98T possibly damaging Het
Zfp462 A G 4: 55,010,668 Y878C probably damaging Het
Zfp474 T C 18: 52,638,431 I52T possibly damaging Het
Other mutations in Traf4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01351:Traf4 APN 11 78165400 missense possibly damaging 0.93
IGL01354:Traf4 APN 11 78165400 missense possibly damaging 0.93
IGL01361:Traf4 APN 11 78165400 missense possibly damaging 0.93
IGL01375:Traf4 APN 11 78160082 missense probably benign 0.00
IGL01991:Traf4 APN 11 78160046 missense possibly damaging 0.87
IGL02243:Traf4 APN 11 78160517 missense probably benign 0.00
IGL02800:Traf4 APN 11 78160235 missense possibly damaging 0.67
IGL02883:Traf4 APN 11 78161621 missense possibly damaging 0.72
PIT4453001:Traf4 UTSW 11 78161534 missense probably benign
R2104:Traf4 UTSW 11 78160014 missense probably damaging 0.99
R2199:Traf4 UTSW 11 78159980 missense probably damaging 1.00
R2298:Traf4 UTSW 11 78160851 missense probably benign 0.08
R2351:Traf4 UTSW 11 78160176 missense probably damaging 1.00
R4547:Traf4 UTSW 11 78161037 missense possibly damaging 0.85
R6905:Traf4 UTSW 11 78160442 missense probably benign 0.03
R6907:Traf4 UTSW 11 78160442 missense probably benign 0.03
R7384:Traf4 UTSW 11 78160791 critical splice donor site probably null
R9051:Traf4 UTSW 11 78161179 missense probably damaging 1.00
R9205:Traf4 UTSW 11 78161101 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- CCACAGGGGTTAAGTTAGGG -3'
(R):5'- ACAGCCAGCTCAGTTGAGAG -3'

Sequencing Primer
(F):5'- AATTCACACTTGAGGCGGC -3'
(R):5'- GTGGGGTGGATAGCAACTCC -3'
Posted On 2016-10-03