Mutagenetix > Incidental Mutation

Incidental Mutation 'R5484:Atp4a'

430310

Institutional Source

Beutler Lab

Gene Symbol

Atp4a

Ensembl Gene

ENSMUSG00000005553

Gene Name

ATPase, H+/K+ exchanging, gastric, alpha polypeptide

Synonyms

H+/K+-ATPase alpha, H+K+-transporting alpha 1

MMRRC Submission

043045-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.098) question?

Stock #

R5484 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

30712209-30725534 bp(+) (GRCm38)

Type of Mutation

unclassified

DNA Base Change (assembly)

G to A at 30720672 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000127209 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000005692] [ENSMUST00000170371] [ENSMUST00000171014]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000005692

SMART Domains

Protein: ENSMUSP00000005692
Gene: ENSMUSG00000005553

Domain	Start	End	E-Value	Type
Pfam:H-K_ATPase_N	2	42	5.4e-23	PFAM
Cation_ATPase_N	52	126	2.26e-18	SMART
Pfam:E1-E2_ATPase	144	375	1.1e-57	PFAM
Pfam:Hydrolase	380	739	5.3e-16	PFAM
Pfam:HAD	383	736	1.9e-18	PFAM
Pfam:Cation_ATPase	436	531	1.6e-24	PFAM
Pfam:Cation_ATPase_C	809	1019	4.8e-43	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000165410

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000167761

Predicted Effect

probably benign
Transcript: ENSMUST00000170371

SMART Domains

Protein: ENSMUSP00000131964
Gene: ENSMUSG00000005553

Domain	Start	End	E-Value	Type
Pfam:H-K_ATPase_N	2	42	4.9e-28	PFAM
Cation_ATPase_N	52	126	2.26e-18	SMART
Pfam:E1-E2_ATPase	145	376	1e-62	PFAM
Pfam:Hydrolase	380	730	9.3e-25	PFAM
Pfam:HAD	383	727	2.1e-15	PFAM
Pfam:Hydrolase_like2	436	531	4e-25	PFAM
Pfam:Cation_ATPase_C	800	1010	1.5e-42	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000171014

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 98.3%
3x: 97.3%
10x: 95.3%
20x: 91.4%

Validation Efficiency

97% (76/78)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a family of P-type cation-transporting ATPases. The gastric H+, K+-ATPase is a heterodimer consisting of a high molecular weight catalytic alpha subunit and a smaller but heavily glycosylated beta subunit. This enzyme is a proton pump that catalyzes the hydrolysis of ATP coupled with the exchange of H(+) and K(+) ions across the plasma membrane. It is also responsible for gastric acid secretion. This gene encodes a catalytic alpha subunit of the gastric H+, K+-ATPase. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in achlorhydria, hypergastrinemia, and abnormalities of the parietal cells. Mice homozygous for an ENU-induced allele exhibit iron-deficiency anemia. [provided by MGI curators]

Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Targeted, other(2)

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921509C19Rik	T	C	2: 151,471,931	H609R	probably benign	Het
Abca6	A	T	11: 110,184,073	V1388E	probably damaging	Het
Alx1	T	A	10: 103,025,316	D117V	probably damaging	Het
Ascl4	T	C	10: 85,928,537	L16P	probably damaging	Het
Btnl10	G	A	11: 58,923,825	V444M	probably damaging	Het
Camkv	A	T	9: 107,946,146	N124Y	probably damaging	Het
Catsperb	T	C	12: 101,575,916	L625P	probably benign	Het
Ccdc171	A	G	4: 83,693,962	I973V	probably benign	Het
Celsr1	T	C	15: 85,931,282	D1844G	probably benign	Het
Chd7	G	C	4: 8,828,258	K1066N	probably damaging	Het
Cmklr1	C	G	5: 113,614,929	D4H	possibly damaging	Het
Corin	T	C	5: 72,358,484	D409G	probably benign	Het
Cry1	T	C	10: 85,146,724		probably null	Het
Cttnbp2	T	A	6: 18,427,690		probably benign	Het
Dmxl1	T	A	18: 49,889,464	V1623E	probably damaging	Het
Dnah6	G	T	6: 73,092,116	D2477E	possibly damaging	Het
Dnajb12	GC	G	10: 59,892,752		probably null	Het
Dopey1	C	G	9: 86,545,288	R2164G	probably damaging	Het
Dsp	A	G	13: 38,184,038	T678A	possibly damaging	Het
Fam129a	A	G	1: 151,718,086	T841A	probably benign	Het
Fam49b	T	A	15: 63,943,207	T139S	probably damaging	Het
Farsb	A	C	1: 78,476,196	I51S	probably damaging	Het
Gm10220	T	A	5: 26,117,932	I161L	possibly damaging	Het
Gm10782	G	T	13: 56,363,174		noncoding transcript	Het
Gm12830	A	T	4: 114,845,051	T137S	unknown	Het
Gopc	A	G	10: 52,358,846	L67P	probably damaging	Het
Hmcn1	T	C	1: 150,675,540	I2655V	probably benign	Het
Hmcn2	C	T	2: 31,393,054	Q1981*	probably null	Het
Ifi209	T	A	1: 173,641,074	S157T	probably benign	Het
Iqcf1	A	T	9: 106,501,908	I74F	probably damaging	Het
Irf3	A	T	7: 44,999,958	R78W	probably damaging	Het
Kank4	T	C	4: 98,774,785	D722G	probably benign	Het
Loxl1	A	G	9: 58,290,782	V597A	possibly damaging	Het
Marveld1	T	C	19: 42,147,833	L62P	probably damaging	Het
Mga	T	G	2: 119,916,626	D419E	possibly damaging	Het
Mroh2a	A	G	1: 88,258,664	S64G	probably benign	Het
Mroh2b	A	G	15: 4,908,981	K251E	possibly damaging	Het
Myh4	A	G	11: 67,251,818	E935G	probably damaging	Het
Nat8f2	C	A	6: 85,868,012	A123S	possibly damaging	Het
Olfr1423	G	A	19: 12,035,828	L305F	probably benign	Het
Pcdha9	T	A	18: 36,998,103	V75E	probably damaging	Het
Pebp4	A	T	14: 69,963,542		probably null	Het
Pitx1	A	G	13: 55,826,353	S222P	probably benign	Het
Plekhg3	G	A	12: 76,578,400	V1339M	possibly damaging	Het
Plekhs1	C	T	19: 56,479,828	S276L	possibly damaging	Het
Plin4	T	C	17: 56,104,932	T700A	possibly damaging	Het
Plxnb2	T	C	15: 89,164,209		probably null	Het
Pms2	T	C	5: 143,928,125	I675T	probably damaging	Het
Polrmt	A	G	10: 79,742,054	L268P	probably damaging	Het
Rtp1	A	G	16: 23,429,275	T33A	probably benign	Het
Safb2	T	C	17: 56,575,346		probably benign	Het
Sdk1	C	A	5: 142,100,186	P1383Q	probably damaging	Het
Setdb1	A	T	3: 95,337,258	C758S	probably damaging	Het
Sh3gl2	T	C	4: 85,398,923		probably benign	Het
Slc13a2	G	A	11: 78,404,822		probably benign	Het
Slc35b1	T	C	11: 95,387,805	Y126H	probably damaging	Het
Strip2	C	A	6: 29,917,155		probably benign	Het
Tbx4	A	G	11: 85,914,404	T440A	probably damaging	Het
Tcf7l2	C	A	19: 55,919,508		probably null	Het
Tgfb1	A	C	7: 25,688,149	D94A	probably benign	Het
Tmem132b	T	C	5: 125,787,733	C968R	probably damaging	Het
Tmem176b	T	A	6: 48,834,533	M61L	probably benign	Het
Tmem258	A	G	19: 10,207,325		probably null	Het
Tpr	T	C	1: 150,426,888	L1379S	probably benign	Het
Ttc26	T	G	6: 38,389,122	C124W	probably benign	Het
Vmn2r44	T	C	7: 8,380,124	D157G	possibly damaging	Het
Wfdc8	T	C	2: 164,597,729	I244M	probably benign	Het
Zfp341	T	C	2: 154,625,001	S97P	probably benign	Het
Zfp655	T	C	5: 145,243,635	V101A	probably benign	Het
Zfp788	T	C	7: 41,649,853	S586P	probably damaging	Het
Zfp874b	C	T	13: 67,481,254	V52I	possibly damaging	Het

Other mutations in Atp4a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00339:Atp4a	APN	7	30713204	missense	possibly damaging	0.95
IGL01327:Atp4a	APN	7	30713250	missense	possibly damaging	0.96
IGL01510:Atp4a	APN	7	30720791	missense	probably benign	0.02
IGL01763:Atp4a	APN	7	30715518	missense	probably benign	0.20
IGL02061:Atp4a	APN	7	30715029	missense	probably damaging	1.00
IGL02435:Atp4a	APN	7	30717057	missense	probably benign
IGL02903:Atp4a	APN	7	30715919	missense	probably benign	0.00
IGL03181:Atp4a	APN	7	30724704	missense	probably benign	0.02
IGL03350:Atp4a	APN	7	30720867	missense	probably damaging	1.00
atypical	UTSW	7	30715356	missense	possibly damaging	0.84
sublytic	UTSW	7	30715800	missense	probably benign	0.32
IGL03097:Atp4a	UTSW	7	30723037	missense	probably benign	0.14
R0095:Atp4a	UTSW	7	30720735	missense	probably damaging	0.99
R0121:Atp4a	UTSW	7	30720101	missense	probably benign	0.00
R0140:Atp4a	UTSW	7	30720101	missense	probably benign	0.00
R0241:Atp4a	UTSW	7	30717135	missense	probably benign	0.00
R0437:Atp4a	UTSW	7	30720101	missense	probably benign	0.00
R0624:Atp4a	UTSW	7	30718999	missense	probably benign
R1164:Atp4a	UTSW	7	30717692	missense	probably benign	0.00
R2105:Atp4a	UTSW	7	30720368	critical splice donor site	probably null
R2272:Atp4a	UTSW	7	30715500	nonsense	probably null
R2327:Atp4a	UTSW	7	30720241	missense	probably benign	0.16
R2881:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R2990:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R2992:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R2993:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R3123:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R3125:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R3441:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R3442:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R3686:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R3687:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R3845:Atp4a	UTSW	7	30717115	missense	probably null	0.99
R4027:Atp4a	UTSW	7	30724952	splice site	probably null
R4072:Atp4a	UTSW	7	30715332	missense	probably benign	0.09
R4433:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R4454:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R4457:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R4458:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R4510:Atp4a	UTSW	7	30724253	nonsense	probably null
R4511:Atp4a	UTSW	7	30724253	nonsense	probably null
R4576:Atp4a	UTSW	7	30717722	missense	probably benign	0.25
R4656:Atp4a	UTSW	7	30719948	intron	probably benign
R4661:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R4662:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R4852:Atp4a	UTSW	7	30724268	missense	probably benign	0.10
R4892:Atp4a	UTSW	7	30712474	missense	probably benign	0.07
R4907:Atp4a	UTSW	7	30719092	missense	possibly damaging	0.66
R5024:Atp4a	UTSW	7	30715864	missense	possibly damaging	0.82
R5254:Atp4a	UTSW	7	30715530	missense	probably damaging	1.00
R5318:Atp4a	UTSW	7	30715329	missense	probably damaging	1.00
R5340:Atp4a	UTSW	7	30720806	missense	probably benign
R5729:Atp4a	UTSW	7	30712426	missense	possibly damaging	0.48
R5762:Atp4a	UTSW	7	30719096	missense	probably damaging	0.99
R5797:Atp4a	UTSW	7	30712649	missense	probably damaging	1.00
R6030:Atp4a	UTSW	7	30722516	missense	probably damaging	0.99
R6030:Atp4a	UTSW	7	30722516	missense	probably damaging	0.99
R6077:Atp4a	UTSW	7	30715919	missense	probably benign	0.00
R6243:Atp4a	UTSW	7	30715957	missense	possibly damaging	0.68
R6346:Atp4a	UTSW	7	30715356	missense	possibly damaging	0.84
R6459:Atp4a	UTSW	7	30712462	missense	probably benign	0.00
R6515:Atp4a	UTSW	7	30712478	missense	possibly damaging	0.78
R6773:Atp4a	UTSW	7	30715377	missense	probably damaging	0.98
R6854:Atp4a	UTSW	7	30715008	missense	probably benign	0.29
R7215:Atp4a	UTSW	7	30717360	missense	possibly damaging	0.61
R7271:Atp4a	UTSW	7	30722519	missense	probably benign	0.16
R7340:Atp4a	UTSW	7	30716730	missense	possibly damaging	0.94
R7457:Atp4a	UTSW	7	30720767	missense	probably benign	0.08
R7593:Atp4a	UTSW	7	30724680	missense	probably benign	0.08
R7712:Atp4a	UTSW	7	30715553	missense	probably damaging	0.96
R7762:Atp4a	UTSW	7	30720036	missense	probably damaging	0.96
R8714:Atp4a	UTSW	7	30720588	missense	probably damaging	0.99
R9324:Atp4a	UTSW	7	30715782	missense	probably benign	0.02
Z1177:Atp4a	UTSW	7	30717840	missense	possibly damaging	0.47
Z1186:Atp4a	UTSW	7	30717357	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GGGATGGTGTGAATGACTCC -3'
(R):5'- AGACTCACGATATCTGTGCAG -3'

Sequencing Primer
(F):5'- ATGGTGTGAATGACTCCCCAGC -3'
(R):5'- GACTCACGATATCTGTGCAGAGTTC -3'

Posted On

2016-10-05