Incidental Mutation 'R5484:Slc13a2'
ID430324
Institutional Source Beutler Lab
Gene Symbol Slc13a2
Ensembl Gene ENSMUSG00000001095
Gene Namesolute carrier family 13 (sodium-dependent dicarboxylate transporter), member 2
Synonymssodium/dicarboxylate co-transporter, Nadc1, mNaDC-1
MMRRC Submission 043045-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5484 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location78397087-78422217 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to A at 78404822 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000001122 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001122]
Predicted Effect probably benign
Transcript: ENSMUST00000001122
SMART Domains Protein: ENSMUSP00000001122
Gene: ENSMUSG00000001095

DomainStartEndE-ValueType
Pfam:Na_sulph_symp 6 560 7.1e-161 PFAM
Pfam:CitMHS 45 164 3e-15 PFAM
Pfam:CitMHS 203 499 1.5e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149865
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.3%
  • 20x: 91.4%
Validation Efficiency 97% (76/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a sodium-coupled citrate transporter that is regulated by the chaperone activity of cyclophilin b. The encoded protein may play a role in the formation of kidney stones. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased Kreb cycle intermediates in the urine but otherwise have normal kidney function and response to ischemia-reperfusion injury and caloric restriction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik T C 2: 151,471,931 H609R probably benign Het
Abca6 A T 11: 110,184,073 V1388E probably damaging Het
Alx1 T A 10: 103,025,316 D117V probably damaging Het
Ascl4 T C 10: 85,928,537 L16P probably damaging Het
Atp4a G A 7: 30,720,672 probably benign Het
Btnl10 G A 11: 58,923,825 V444M probably damaging Het
Camkv A T 9: 107,946,146 N124Y probably damaging Het
Catsperb T C 12: 101,575,916 L625P probably benign Het
Ccdc171 A G 4: 83,693,962 I973V probably benign Het
Celsr1 T C 15: 85,931,282 D1844G probably benign Het
Chd7 G C 4: 8,828,258 K1066N probably damaging Het
Cmklr1 C G 5: 113,614,929 D4H possibly damaging Het
Corin T C 5: 72,358,484 D409G probably benign Het
Cry1 T C 10: 85,146,724 probably null Het
Cttnbp2 T A 6: 18,427,690 probably benign Het
Dmxl1 T A 18: 49,889,464 V1623E probably damaging Het
Dnah6 G T 6: 73,092,116 D2477E possibly damaging Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Dopey1 C G 9: 86,545,288 R2164G probably damaging Het
Dsp A G 13: 38,184,038 T678A possibly damaging Het
Fam129a A G 1: 151,718,086 T841A probably benign Het
Fam49b T A 15: 63,943,207 T139S probably damaging Het
Farsb A C 1: 78,476,196 I51S probably damaging Het
Gm10220 T A 5: 26,117,932 I161L possibly damaging Het
Gm10782 G T 13: 56,363,174 noncoding transcript Het
Gm12830 A T 4: 114,845,051 T137S unknown Het
Gopc A G 10: 52,358,846 L67P probably damaging Het
Hmcn1 T C 1: 150,675,540 I2655V probably benign Het
Hmcn2 C T 2: 31,393,054 Q1981* probably null Het
Ifi209 T A 1: 173,641,074 S157T probably benign Het
Iqcf1 A T 9: 106,501,908 I74F probably damaging Het
Irf3 A T 7: 44,999,958 R78W probably damaging Het
Kank4 T C 4: 98,774,785 D722G probably benign Het
Loxl1 A G 9: 58,290,782 V597A possibly damaging Het
Marveld1 T C 19: 42,147,833 L62P probably damaging Het
Mga T G 2: 119,916,626 D419E possibly damaging Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Mroh2b A G 15: 4,908,981 K251E possibly damaging Het
Myh4 A G 11: 67,251,818 E935G probably damaging Het
Nat8f2 C A 6: 85,868,012 A123S possibly damaging Het
Olfr1423 G A 19: 12,035,828 L305F probably benign Het
Pcdha9 T A 18: 36,998,103 V75E probably damaging Het
Pebp4 A T 14: 69,963,542 probably null Het
Pitx1 A G 13: 55,826,353 S222P probably benign Het
Plekhg3 G A 12: 76,578,400 V1339M possibly damaging Het
Plekhs1 C T 19: 56,479,828 S276L possibly damaging Het
Plin4 T C 17: 56,104,932 T700A possibly damaging Het
Plxnb2 T C 15: 89,164,209 probably null Het
Pms2 T C 5: 143,928,125 I675T probably damaging Het
Polrmt A G 10: 79,742,054 L268P probably damaging Het
Rtp1 A G 16: 23,429,275 T33A probably benign Het
Safb2 T C 17: 56,575,346 probably benign Het
Sdk1 C A 5: 142,100,186 P1383Q probably damaging Het
Setdb1 A T 3: 95,337,258 C758S probably damaging Het
Sh3gl2 T C 4: 85,398,923 probably benign Het
Slc35b1 T C 11: 95,387,805 Y126H probably damaging Het
Strip2 C A 6: 29,917,155 probably benign Het
Tbx4 A G 11: 85,914,404 T440A probably damaging Het
Tcf7l2 C A 19: 55,919,508 probably null Het
Tgfb1 A C 7: 25,688,149 D94A probably benign Het
Tmem132b T C 5: 125,787,733 C968R probably damaging Het
Tmem176b T A 6: 48,834,533 M61L probably benign Het
Tmem258 A G 19: 10,207,325 probably null Het
Tpr T C 1: 150,426,888 L1379S probably benign Het
Ttc26 T G 6: 38,389,122 C124W probably benign Het
Vmn2r44 T C 7: 8,380,124 D157G possibly damaging Het
Wfdc8 T C 2: 164,597,729 I244M probably benign Het
Zfp341 T C 2: 154,625,001 S97P probably benign Het
Zfp655 T C 5: 145,243,635 V101A probably benign Het
Zfp788 T C 7: 41,649,853 S586P probably damaging Het
Zfp874b C T 13: 67,481,254 V52I possibly damaging Het
Other mutations in Slc13a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Slc13a2 APN 11 78400548 missense probably damaging 1.00
IGL01604:Slc13a2 APN 11 78403395 missense possibly damaging 0.82
IGL01679:Slc13a2 APN 11 78404711 missense probably damaging 1.00
IGL03100:Slc13a2 APN 11 78404473 missense probably damaging 1.00
IGL03380:Slc13a2 APN 11 78399082 missense probably benign 0.03
deliberate UTSW 11 78403480 critical splice acceptor site probably benign
Familiaris UTSW 11 78404795 missense probably damaging 1.00
intentional UTSW 11 78404708 missense probably damaging 1.00
R0085:Slc13a2 UTSW 11 78406868 missense probably damaging 0.96
R0324:Slc13a2 UTSW 11 78404524 missense probably damaging 1.00
R0368:Slc13a2 UTSW 11 78404800 nonsense probably null
R0440:Slc13a2 UTSW 11 78403175 missense probably benign 0.05
R0539:Slc13a2 UTSW 11 78399138 missense probably damaging 1.00
R1519:Slc13a2 UTSW 11 78397746 missense possibly damaging 0.59
R1550:Slc13a2 UTSW 11 78403164 missense probably damaging 1.00
R1909:Slc13a2 UTSW 11 78400142 missense possibly damaging 0.90
R2166:Slc13a2 UTSW 11 78403075 missense probably benign 0.16
R2994:Slc13a2 UTSW 11 78404737 missense probably damaging 1.00
R2998:Slc13a2 UTSW 11 78404785 missense probably damaging 0.99
R3418:Slc13a2 UTSW 11 78400840 missense probably benign 0.05
R3932:Slc13a2 UTSW 11 78398400 missense probably damaging 1.00
R4233:Slc13a2 UTSW 11 78403535 intron probably benign
R4462:Slc13a2 UTSW 11 78404387 missense probably benign 0.44
R5014:Slc13a2 UTSW 11 78400161 missense possibly damaging 0.73
R5170:Slc13a2 UTSW 11 78400808 missense probably damaging 1.00
R5809:Slc13a2 UTSW 11 78397821 missense probably damaging 1.00
R5973:Slc13a2 UTSW 11 78400532 missense probably damaging 0.99
R6243:Slc13a2 UTSW 11 78404708 missense probably damaging 1.00
R6263:Slc13a2 UTSW 11 78403480 critical splice acceptor site probably benign
R6275:Slc13a2 UTSW 11 78403480 critical splice acceptor site probably benign
R6276:Slc13a2 UTSW 11 78403480 critical splice acceptor site probably benign
R6279:Slc13a2 UTSW 11 78403480 critical splice acceptor site probably benign
R6280:Slc13a2 UTSW 11 78403480 critical splice acceptor site probably benign
R6300:Slc13a2 UTSW 11 78403480 critical splice acceptor site probably benign
R6305:Slc13a2 UTSW 11 78403480 critical splice acceptor site probably benign
R6314:Slc13a2 UTSW 11 78403480 critical splice acceptor site probably benign
R6673:Slc13a2 UTSW 11 78397831 missense probably benign 0.12
R7138:Slc13a2 UTSW 11 78399124 missense possibly damaging 0.76
R7382:Slc13a2 UTSW 11 78404795 missense probably damaging 1.00
R7657:Slc13a2 UTSW 11 78398397 missense probably damaging 0.99
R7791:Slc13a2 UTSW 11 78422064 critical splice donor site probably null
R8027:Slc13a2 UTSW 11 78404756 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CATAGGATGCCCGTTTGTTCC -3'
(R):5'- CTAGAGCCTCCCAGTCTTTG -3'

Sequencing Primer
(F):5'- CTCCCACCTGGCTAGCAC -3'
(R):5'- CCTCCCAGTCTTTGAGAGGAGAAG -3'
Posted On2016-10-05