Incidental Mutation 'R5484:Abca6'
ID430327
Institutional Source Beutler Lab
Gene Symbol Abca6
Ensembl Gene ENSMUSG00000044749
Gene NameATP-binding cassette, sub-family A (ABC1), member 6
Synonyms6330565N06Rik
MMRRC Submission 043045-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5484 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location110176820-110251776 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 110184073 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 1388 (V1388E)
Ref Sequence ENSEMBL: ENSMUSP00000035458 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044003]
Predicted Effect probably damaging
Transcript: ENSMUST00000044003
AA Change: V1388E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035458
Gene: ENSMUSG00000044749
AA Change: V1388E

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 28 416 1.4e-42 PFAM
low complexity region 484 495 N/A INTRINSIC
AAA 506 691 1.13e-6 SMART
transmembrane domain 854 876 N/A INTRINSIC
transmembrane domain 971 990 N/A INTRINSIC
transmembrane domain 1005 1027 N/A INTRINSIC
Blast:AAA 1041 1176 4e-21 BLAST
transmembrane domain 1191 1213 N/A INTRINSIC
low complexity region 1243 1254 N/A INTRINSIC
AAA 1312 1505 2.43e-6 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.3%
  • 20x: 91.4%
Validation Efficiency 97% (76/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, and White). This encoded protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. This gene is clustered among 4 other ABC1 family members on 17q24 and may play a role in macrophage lipid homeostasis. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik T C 2: 151,471,931 H609R probably benign Het
Alx1 T A 10: 103,025,316 D117V probably damaging Het
Ascl4 T C 10: 85,928,537 L16P probably damaging Het
Atp4a G A 7: 30,720,672 probably benign Het
Btnl10 G A 11: 58,923,825 V444M probably damaging Het
Camkv A T 9: 107,946,146 N124Y probably damaging Het
Catsperb T C 12: 101,575,916 L625P probably benign Het
Ccdc171 A G 4: 83,693,962 I973V probably benign Het
Celsr1 T C 15: 85,931,282 D1844G probably benign Het
Chd7 G C 4: 8,828,258 K1066N probably damaging Het
Cmklr1 C G 5: 113,614,929 D4H possibly damaging Het
Corin T C 5: 72,358,484 D409G probably benign Het
Cry1 T C 10: 85,146,724 probably null Het
Cttnbp2 T A 6: 18,427,690 probably benign Het
Dmxl1 T A 18: 49,889,464 V1623E probably damaging Het
Dnah6 G T 6: 73,092,116 D2477E possibly damaging Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Dopey1 C G 9: 86,545,288 R2164G probably damaging Het
Dsp A G 13: 38,184,038 T678A possibly damaging Het
Fam129a A G 1: 151,718,086 T841A probably benign Het
Fam49b T A 15: 63,943,207 T139S probably damaging Het
Farsb A C 1: 78,476,196 I51S probably damaging Het
Gm10220 T A 5: 26,117,932 I161L possibly damaging Het
Gm10782 G T 13: 56,363,174 noncoding transcript Het
Gm12830 A T 4: 114,845,051 T137S unknown Het
Gopc A G 10: 52,358,846 L67P probably damaging Het
Hmcn1 T C 1: 150,675,540 I2655V probably benign Het
Hmcn2 C T 2: 31,393,054 Q1981* probably null Het
Ifi209 T A 1: 173,641,074 S157T probably benign Het
Iqcf1 A T 9: 106,501,908 I74F probably damaging Het
Irf3 A T 7: 44,999,958 R78W probably damaging Het
Kank4 T C 4: 98,774,785 D722G probably benign Het
Loxl1 A G 9: 58,290,782 V597A possibly damaging Het
Marveld1 T C 19: 42,147,833 L62P probably damaging Het
Mga T G 2: 119,916,626 D419E possibly damaging Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Mroh2b A G 15: 4,908,981 K251E possibly damaging Het
Myh4 A G 11: 67,251,818 E935G probably damaging Het
Nat8f2 C A 6: 85,868,012 A123S possibly damaging Het
Olfr1423 G A 19: 12,035,828 L305F probably benign Het
Pcdha9 T A 18: 36,998,103 V75E probably damaging Het
Pebp4 A T 14: 69,963,542 probably null Het
Pitx1 A G 13: 55,826,353 S222P probably benign Het
Plekhg3 G A 12: 76,578,400 V1339M possibly damaging Het
Plekhs1 C T 19: 56,479,828 S276L possibly damaging Het
Plin4 T C 17: 56,104,932 T700A possibly damaging Het
Plxnb2 T C 15: 89,164,209 probably null Het
Pms2 T C 5: 143,928,125 I675T probably damaging Het
Polrmt A G 10: 79,742,054 L268P probably damaging Het
Rtp1 A G 16: 23,429,275 T33A probably benign Het
Safb2 T C 17: 56,575,346 probably benign Het
Sdk1 C A 5: 142,100,186 P1383Q probably damaging Het
Setdb1 A T 3: 95,337,258 C758S probably damaging Het
Sh3gl2 T C 4: 85,398,923 probably benign Het
Slc13a2 G A 11: 78,404,822 probably benign Het
Slc35b1 T C 11: 95,387,805 Y126H probably damaging Het
Strip2 C A 6: 29,917,155 probably benign Het
Tbx4 A G 11: 85,914,404 T440A probably damaging Het
Tcf7l2 C A 19: 55,919,508 probably null Het
Tgfb1 A C 7: 25,688,149 D94A probably benign Het
Tmem132b T C 5: 125,787,733 C968R probably damaging Het
Tmem176b T A 6: 48,834,533 M61L probably benign Het
Tmem258 A G 19: 10,207,325 probably null Het
Tpr T C 1: 150,426,888 L1379S probably benign Het
Ttc26 T G 6: 38,389,122 C124W probably benign Het
Vmn2r44 T C 7: 8,380,124 D157G possibly damaging Het
Wfdc8 T C 2: 164,597,729 I244M probably benign Het
Zfp341 T C 2: 154,625,001 S97P probably benign Het
Zfp655 T C 5: 145,243,635 V101A probably benign Het
Zfp788 T C 7: 41,649,853 S586P probably damaging Het
Zfp874b C T 13: 67,481,254 V52I possibly damaging Het
Other mutations in Abca6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Abca6 APN 11 110184709 missense probably damaging 1.00
IGL00569:Abca6 APN 11 110187049 missense possibly damaging 0.88
IGL00737:Abca6 APN 11 110196997 splice site probably benign
IGL01024:Abca6 APN 11 110197142 missense probably benign
IGL01087:Abca6 APN 11 110191650 missense probably benign 0.00
IGL01511:Abca6 APN 11 110244310 missense probably benign 0.00
IGL01516:Abca6 APN 11 110218217 missense possibly damaging 0.70
IGL01621:Abca6 APN 11 110184708 missense probably damaging 1.00
IGL01749:Abca6 APN 11 110244224 missense probably damaging 1.00
IGL01934:Abca6 APN 11 110188655 missense probably benign 0.00
IGL02010:Abca6 APN 11 110219616 missense probably benign 0.12
IGL02121:Abca6 APN 11 110182924 missense probably benign 0.38
IGL02423:Abca6 APN 11 110219006 splice site probably benign
IGL02428:Abca6 APN 11 110178792 missense possibly damaging 0.81
IGL02491:Abca6 APN 11 110176968 utr 3 prime probably benign
IGL02541:Abca6 APN 11 110212267 missense probably damaging 1.00
IGL02792:Abca6 APN 11 110188681 missense probably damaging 0.99
IGL02836:Abca6 APN 11 110248548 missense probably damaging 1.00
IGL02965:Abca6 APN 11 110180613 missense probably benign
IGL03094:Abca6 APN 11 110184112 missense probably benign 0.03
IGL03109:Abca6 APN 11 110180347 missense probably damaging 0.96
R0068:Abca6 UTSW 11 110182882 missense probably damaging 1.00
R0142:Abca6 UTSW 11 110188641 missense probably damaging 1.00
R0165:Abca6 UTSW 11 110219604 missense possibly damaging 0.90
R0254:Abca6 UTSW 11 110236789 missense probably benign 0.16
R0598:Abca6 UTSW 11 110197154 missense probably damaging 1.00
R0992:Abca6 UTSW 11 110211684 missense probably damaging 1.00
R1386:Abca6 UTSW 11 110244255 missense probably benign 0.02
R1642:Abca6 UTSW 11 110218281 missense possibly damaging 0.73
R1673:Abca6 UTSW 11 110212339 missense probably benign 0.01
R1792:Abca6 UTSW 11 110184044 missense probably benign 0.00
R1813:Abca6 UTSW 11 110233845 splice site probably benign
R1817:Abca6 UTSW 11 110219318 missense probably benign 0.00
R1842:Abca6 UTSW 11 110197039 missense probably benign 0.00
R1898:Abca6 UTSW 11 110208799 missense probably damaging 0.99
R1914:Abca6 UTSW 11 110212210 missense probably benign 0.06
R1915:Abca6 UTSW 11 110212210 missense probably benign 0.06
R1934:Abca6 UTSW 11 110210083 critical splice donor site probably null
R1964:Abca6 UTSW 11 110184676 missense probably damaging 0.98
R1967:Abca6 UTSW 11 110187148 missense probably benign 0.09
R2127:Abca6 UTSW 11 110219649 missense probably benign 0.00
R2128:Abca6 UTSW 11 110219649 missense probably benign 0.00
R2164:Abca6 UTSW 11 110210193 frame shift probably null
R2895:Abca6 UTSW 11 110202426 missense probably benign 0.00
R3110:Abca6 UTSW 11 110178829 nonsense probably null
R3111:Abca6 UTSW 11 110178829 nonsense probably null
R3112:Abca6 UTSW 11 110178829 nonsense probably null
R4094:Abca6 UTSW 11 110180366 missense probably damaging 1.00
R4432:Abca6 UTSW 11 110241588 missense probably benign 0.11
R4474:Abca6 UTSW 11 110233772 missense possibly damaging 0.46
R4572:Abca6 UTSW 11 110216548 missense probably benign 0.31
R4629:Abca6 UTSW 11 110230549 critical splice acceptor site probably null
R4793:Abca6 UTSW 11 110191718 missense probably benign
R4852:Abca6 UTSW 11 110244203 missense probably benign 0.09
R4867:Abca6 UTSW 11 110202379 missense probably benign 0.01
R4879:Abca6 UTSW 11 110219700 missense probably damaging 0.98
R4918:Abca6 UTSW 11 110180551 missense probably damaging 1.00
R5060:Abca6 UTSW 11 110219604 missense possibly damaging 0.90
R5062:Abca6 UTSW 11 110177066 missense probably benign 0.12
R5083:Abca6 UTSW 11 110218967 missense probably damaging 1.00
R5173:Abca6 UTSW 11 110191720 missense probably benign
R5393:Abca6 UTSW 11 110244295 missense probably benign 0.00
R5498:Abca6 UTSW 11 110208844 missense possibly damaging 0.95
R5503:Abca6 UTSW 11 110218257 missense probably damaging 1.00
R5645:Abca6 UTSW 11 110250408 missense probably damaging 0.99
R5680:Abca6 UTSW 11 110236645 missense possibly damaging 0.88
R5761:Abca6 UTSW 11 110210101 missense probably damaging 1.00
R5779:Abca6 UTSW 11 110184670 missense probably benign 0.37
R5818:Abca6 UTSW 11 110219643 missense probably damaging 1.00
R6282:Abca6 UTSW 11 110208824 missense probably damaging 0.98
R6455:Abca6 UTSW 11 110241581 missense probably damaging 1.00
R6826:Abca6 UTSW 11 110216605 missense probably benign 0.15
R6857:Abca6 UTSW 11 110219688 missense possibly damaging 0.63
R6914:Abca6 UTSW 11 110190238 missense probably benign
R6931:Abca6 UTSW 11 110244328 missense probably benign 0.27
R7222:Abca6 UTSW 11 110191693 missense probably benign 0.29
R7242:Abca6 UTSW 11 110241653 missense possibly damaging 0.47
R7297:Abca6 UTSW 11 110183026 critical splice donor site probably null
R7387:Abca6 UTSW 11 110202420 missense probably benign
R7420:Abca6 UTSW 11 110250477 missense probably benign 0.24
R7494:Abca6 UTSW 11 110208745 missense possibly damaging 0.93
R7603:Abca6 UTSW 11 110180258 missense possibly damaging 0.69
R7637:Abca6 UTSW 11 110218952 missense probably benign 0.00
R7674:Abca6 UTSW 11 110219297 missense probably damaging 1.00
R7753:Abca6 UTSW 11 110184107 missense probably damaging 1.00
R7800:Abca6 UTSW 11 110187872 missense probably benign 0.00
R7842:Abca6 UTSW 11 110196697 missense possibly damaging 0.76
R7855:Abca6 UTSW 11 110191628 missense probably benign 0.01
R8119:Abca6 UTSW 11 110197104 missense probably benign 0.00
R8139:Abca6 UTSW 11 110184133 missense probably damaging 1.00
R8176:Abca6 UTSW 11 110244194 missense probably benign 0.01
R8179:Abca6 UTSW 11 110245274 missense probably damaging 1.00
R8197:Abca6 UTSW 11 110211815 missense probably damaging 0.99
R8241:Abca6 UTSW 11 110188630 missense probably null 1.00
R8404:Abca6 UTSW 11 110219319 missense probably damaging 0.99
R8429:Abca6 UTSW 11 110202382 missense probably benign
R8502:Abca6 UTSW 11 110219319 missense probably damaging 0.99
R8816:Abca6 UTSW 11 110236687 missense probably benign 0.04
X0024:Abca6 UTSW 11 110244255 missense probably benign 0.02
X0064:Abca6 UTSW 11 110197142 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTTAAGCTCCCACATTCAGGC -3'
(R):5'- CATTTCCAGATAGTGTGCAGGAAG -3'

Sequencing Primer
(F):5'- TCCCACATTCAGGCATGTAGG -3'
(R):5'- ATAGTGTGCAGGAAGGGCTTC -3'
Posted On2016-10-05