Mutagenetix > Incidental Mutation

Incidental Mutation 'R5484:Celsr1'

430337

Institutional Source

Beutler Lab

Gene Symbol

Celsr1

Ensembl Gene

ENSMUSG00000016028

Gene Name

cadherin, EGF LAG seven-pass G-type receptor 1

Synonyms

crash, Crsh, Scy

MMRRC Submission

043045-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.579) question?

Stock #

R5484 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

85898929-86033777 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 85931282 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 1844 (D1844G)

Ref Sequence

ENSEMBL: ENSMUSP00000016172 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000016172]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000016172
AA Change: D1844G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000016172
Gene: ENSMUSG00000016028
AA Change: D1844G

Domain	Start	End	E-Value	Type
signal peptide	1	29	N/A	INTRINSIC
low complexity region	65	93	N/A	INTRINSIC
low complexity region	221	240	N/A	INTRINSIC
low complexity region	243	257	N/A	INTRINSIC
CA	282	366	9.51e-26	SMART
CA	390	472	1.59e-27	SMART
CA	496	578	3.8e-25	SMART
CA	602	700	2.25e-27	SMART
CA	724	802	3.14e-17	SMART
CA	826	905	2.67e-29	SMART
CA	929	1012	3.23e-28	SMART
CA	1036	1114	4.17e-22	SMART
CA	1142	1218	6.89e-1	SMART
EGF	1321	1376	3.38e-3	SMART
EGF	1381	1414	5.49e-3	SMART
EGF	1421	1456	9.7e-4	SMART
LamG	1477	1644	2.53e-33	SMART
EGF	1667	1700	6.4e-4	SMART
LamG	1726	1864	1.13e-21	SMART
EGF	1890	1923	1.84e-4	SMART
EGF	1925	1961	5.49e-3	SMART
EGF_Lam	2018	2063	7.12e-11	SMART
HormR	2066	2128	2.55e-20	SMART
Pfam:GAIN	2140	2396	1.1e-64	PFAM
GPS	2422	2475	5.03e-22	SMART
Pfam:7tm_2	2480	2712	2.6e-60	PFAM
low complexity region	2738	2753	N/A	INTRINSIC
low complexity region	2819	2852	N/A	INTRINSIC
low complexity region	2976	2988	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000226840
AA Change: D477G

Meta Mutation Damage Score

0.0897

Coding Region Coverage

1x: 98.3%
3x: 97.3%
10x: 95.3%
20x: 91.4%

Validation Efficiency

97% (76/78)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the flamingo subfamily, part of the cadherin superfamily. The flamingo subfamily consists of nonclassic-type cadherins; a subpopulation that does not interact with catenins. The flamingo cadherins are located at the plasma membrane and have nine cadherin domains, seven epidermal growth factor-like repeats and two laminin A G-type repeats in their ectodomain. They also have seven transmembrane domains, a characteristic unique to this subfamily. It is postulated that these proteins are receptors involved in contact-mediated communication, with cadherin domains acting as homophilic binding regions and the EGF-like domains involved in cell adhesion and receptor-ligand interactions. This particular member is a developmentally regulated, neural-specific gene which plays an unspecified role in early embryogenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Nullizygous mice exhibit kinky tails, variable neural tube defects, abnormal hair follicle orientation, whorl-like hair patterns, and partial prenatal lethality. ENU-induced mutants show defects in planar polarity of inner ear hair cells and complete perinatal lethality due to craniorachischisis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921509C19Rik	T	C	2: 151,471,931	H609R	probably benign	Het
Abca6	A	T	11: 110,184,073	V1388E	probably damaging	Het
Alx1	T	A	10: 103,025,316	D117V	probably damaging	Het
Ascl4	T	C	10: 85,928,537	L16P	probably damaging	Het
Atp4a	G	A	7: 30,720,672		probably benign	Het
Btnl10	G	A	11: 58,923,825	V444M	probably damaging	Het
Camkv	A	T	9: 107,946,146	N124Y	probably damaging	Het
Catsperb	T	C	12: 101,575,916	L625P	probably benign	Het
Ccdc171	A	G	4: 83,693,962	I973V	probably benign	Het
Chd7	G	C	4: 8,828,258	K1066N	probably damaging	Het
Cmklr1	C	G	5: 113,614,929	D4H	possibly damaging	Het
Corin	T	C	5: 72,358,484	D409G	probably benign	Het
Cry1	T	C	10: 85,146,724		probably null	Het
Cttnbp2	T	A	6: 18,427,690		probably benign	Het
Dmxl1	T	A	18: 49,889,464	V1623E	probably damaging	Het
Dnah6	G	T	6: 73,092,116	D2477E	possibly damaging	Het
Dnajb12	GC	G	10: 59,892,752		probably null	Het
Dopey1	C	G	9: 86,545,288	R2164G	probably damaging	Het
Dsp	A	G	13: 38,184,038	T678A	possibly damaging	Het
Fam129a	A	G	1: 151,718,086	T841A	probably benign	Het
Fam49b	T	A	15: 63,943,207	T139S	probably damaging	Het
Farsb	A	C	1: 78,476,196	I51S	probably damaging	Het
Gm10220	T	A	5: 26,117,932	I161L	possibly damaging	Het
Gm10782	G	T	13: 56,363,174		noncoding transcript	Het
Gm12830	A	T	4: 114,845,051	T137S	unknown	Het
Gopc	A	G	10: 52,358,846	L67P	probably damaging	Het
Hmcn1	T	C	1: 150,675,540	I2655V	probably benign	Het
Hmcn2	C	T	2: 31,393,054	Q1981*	probably null	Het
Ifi209	T	A	1: 173,641,074	S157T	probably benign	Het
Iqcf1	A	T	9: 106,501,908	I74F	probably damaging	Het
Irf3	A	T	7: 44,999,958	R78W	probably damaging	Het
Kank4	T	C	4: 98,774,785	D722G	probably benign	Het
Loxl1	A	G	9: 58,290,782	V597A	possibly damaging	Het
Marveld1	T	C	19: 42,147,833	L62P	probably damaging	Het
Mga	T	G	2: 119,916,626	D419E	possibly damaging	Het
Mroh2a	A	G	1: 88,258,664	S64G	probably benign	Het
Mroh2b	A	G	15: 4,908,981	K251E	possibly damaging	Het
Myh4	A	G	11: 67,251,818	E935G	probably damaging	Het
Nat8f2	C	A	6: 85,868,012	A123S	possibly damaging	Het
Olfr1423	G	A	19: 12,035,828	L305F	probably benign	Het
Pcdha9	T	A	18: 36,998,103	V75E	probably damaging	Het
Pebp4	A	T	14: 69,963,542		probably null	Het
Pitx1	A	G	13: 55,826,353	S222P	probably benign	Het
Plekhg3	G	A	12: 76,578,400	V1339M	possibly damaging	Het
Plekhs1	C	T	19: 56,479,828	S276L	possibly damaging	Het
Plin4	T	C	17: 56,104,932	T700A	possibly damaging	Het
Plxnb2	T	C	15: 89,164,209		probably null	Het
Pms2	T	C	5: 143,928,125	I675T	probably damaging	Het
Polrmt	A	G	10: 79,742,054	L268P	probably damaging	Het
Rtp1	A	G	16: 23,429,275	T33A	probably benign	Het
Safb2	T	C	17: 56,575,346		probably benign	Het
Sdk1	C	A	5: 142,100,186	P1383Q	probably damaging	Het
Setdb1	A	T	3: 95,337,258	C758S	probably damaging	Het
Sh3gl2	T	C	4: 85,398,923		probably benign	Het
Slc13a2	G	A	11: 78,404,822		probably benign	Het
Slc35b1	T	C	11: 95,387,805	Y126H	probably damaging	Het
Strip2	C	A	6: 29,917,155		probably benign	Het
Tbx4	A	G	11: 85,914,404	T440A	probably damaging	Het
Tcf7l2	C	A	19: 55,919,508		probably null	Het
Tgfb1	A	C	7: 25,688,149	D94A	probably benign	Het
Tmem132b	T	C	5: 125,787,733	C968R	probably damaging	Het
Tmem176b	T	A	6: 48,834,533	M61L	probably benign	Het
Tmem258	A	G	19: 10,207,325		probably null	Het
Tpr	T	C	1: 150,426,888	L1379S	probably benign	Het
Ttc26	T	G	6: 38,389,122	C124W	probably benign	Het
Vmn2r44	T	C	7: 8,380,124	D157G	possibly damaging	Het
Wfdc8	T	C	2: 164,597,729	I244M	probably benign	Het
Zfp341	T	C	2: 154,625,001	S97P	probably benign	Het
Zfp655	T	C	5: 145,243,635	V101A	probably benign	Het
Zfp788	T	C	7: 41,649,853	S586P	probably damaging	Het
Zfp874b	C	T	13: 67,481,254	V52I	possibly damaging	Het

Other mutations in Celsr1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00392:Celsr1	APN	15	85931345	missense	probably benign	0.04
IGL00519:Celsr1	APN	15	86030836	missense	probably damaging	1.00
IGL00909:Celsr1	APN	15	85922235	missense	probably damaging	1.00
IGL01303:Celsr1	APN	15	86030491	missense	probably damaging	0.97
IGL01726:Celsr1	APN	15	85926190	missense	probably benign	0.35
IGL01910:Celsr1	APN	15	85929895	missense	probably benign
IGL01931:Celsr1	APN	15	85907660	missense	probably damaging	1.00
IGL01952:Celsr1	APN	15	85963223	missense	probably benign	0.35
IGL02090:Celsr1	APN	15	85907721	missense	possibly damaging	0.49
IGL02191:Celsr1	APN	15	85979004	missense	possibly damaging	0.69
IGL02372:Celsr1	APN	15	85929907	missense	probably benign	0.01
IGL02413:Celsr1	APN	15	86031226	missense	possibly damaging	0.96
IGL02478:Celsr1	APN	15	85941136	missense	possibly damaging	0.68
IGL02507:Celsr1	APN	15	85900688	utr 3 prime	probably benign
IGL02508:Celsr1	APN	15	86030617	nonsense	probably null
IGL02899:Celsr1	APN	15	86031726	missense	probably damaging	0.98
IGL02939:Celsr1	APN	15	85901472	missense	probably benign
IGL03212:Celsr1	APN	15	85930677	missense	probably benign	0.04
P0028:Celsr1	UTSW	15	85922235	missense	probably damaging	1.00
PIT4305001:Celsr1	UTSW	15	85900937	missense	possibly damaging	0.87
PIT4480001:Celsr1	UTSW	15	86032414	missense	probably damaging	0.99
R0018:Celsr1	UTSW	15	86031042	missense	possibly damaging	0.47
R0018:Celsr1	UTSW	15	86031042	missense	possibly damaging	0.47
R0038:Celsr1	UTSW	15	85929419	missense	possibly damaging	0.65
R0057:Celsr1	UTSW	15	86030762	missense	probably benign	0.02
R0060:Celsr1	UTSW	15	85922198	missense	probably damaging	0.98
R0060:Celsr1	UTSW	15	85922198	missense	probably damaging	0.98
R0279:Celsr1	UTSW	15	85902864	missense	probably benign	0.00
R0570:Celsr1	UTSW	15	85903365	missense	probably benign	0.18
R0611:Celsr1	UTSW	15	85932323	missense	possibly damaging	0.91
R0731:Celsr1	UTSW	15	85901597	missense	probably benign
R0792:Celsr1	UTSW	15	85931276	missense	probably benign	0.02
R0943:Celsr1	UTSW	15	85903288	missense	probably damaging	1.00
R0989:Celsr1	UTSW	15	86031279	missense	probably benign	0.39
R1118:Celsr1	UTSW	15	86032047	missense	probably damaging	1.00
R1237:Celsr1	UTSW	15	85903974	missense	probably benign	0.01
R1239:Celsr1	UTSW	15	85979146	missense	probably damaging	0.99
R1405:Celsr1	UTSW	15	85905434	splice site	probably null
R1405:Celsr1	UTSW	15	85905434	splice site	probably null
R1522:Celsr1	UTSW	15	85931276	missense	probably benign	0.02
R1662:Celsr1	UTSW	15	86031062	missense	probably damaging	1.00
R1673:Celsr1	UTSW	15	85932457	missense	probably benign	0.00
R1795:Celsr1	UTSW	15	86030323	missense	probably damaging	0.99
R1799:Celsr1	UTSW	15	86032685	missense	probably damaging	1.00
R1858:Celsr1	UTSW	15	86032759	missense	probably damaging	1.00
R2040:Celsr1	UTSW	15	86032887	missense	probably damaging	1.00
R2050:Celsr1	UTSW	15	86030547	missense	probably benign	0.02
R2131:Celsr1	UTSW	15	85963223	missense	probably benign	0.35
R2132:Celsr1	UTSW	15	86031967	missense	possibly damaging	0.91
R2189:Celsr1	UTSW	15	85979230	missense	possibly damaging	0.93
R2192:Celsr1	UTSW	15	85916723	missense	possibly damaging	0.93
R4213:Celsr1	UTSW	15	86031807	missense	probably damaging	1.00
R4356:Celsr1	UTSW	15	85978827	missense	probably damaging	1.00
R4414:Celsr1	UTSW	15	85963133	missense	probably benign	0.00
R4414:Celsr1	UTSW	15	85927999	missense	probably damaging	1.00
R4416:Celsr1	UTSW	15	85927999	missense	probably damaging	1.00
R4645:Celsr1	UTSW	15	85916756	missense	probably benign	0.35
R4666:Celsr1	UTSW	15	86030494	missense	probably damaging	1.00
R4687:Celsr1	UTSW	15	85932460	missense	possibly damaging	0.94
R4735:Celsr1	UTSW	15	85906029	critical splice acceptor site	probably null
R4804:Celsr1	UTSW	15	85937953	missense	possibly damaging	0.49
R4995:Celsr1	UTSW	15	85937911	missense	probably damaging	0.99
R5070:Celsr1	UTSW	15	85939134	missense	possibly damaging	0.89
R5218:Celsr1	UTSW	15	85932384	missense	probably damaging	1.00
R5280:Celsr1	UTSW	15	85930546	missense	probably benign
R5310:Celsr1	UTSW	15	85926222	missense	possibly damaging	0.88
R5388:Celsr1	UTSW	15	85925518	missense	probably damaging	0.99
R5639:Celsr1	UTSW	15	86030767	missense	probably damaging	1.00
R5758:Celsr1	UTSW	15	85941264	missense	probably benign	0.27
R5778:Celsr1	UTSW	15	86032955	missense	probably damaging	1.00
R5893:Celsr1	UTSW	15	85904014	missense	probably benign	0.02
R5915:Celsr1	UTSW	15	85937975	missense	probably benign
R5915:Celsr1	UTSW	15	86030349	missense	probably damaging	0.96
R5932:Celsr1	UTSW	15	86032704	missense	probably damaging	1.00
R5950:Celsr1	UTSW	15	86032500	missense	probably damaging	1.00
R5975:Celsr1	UTSW	15	85919038	splice site	probably null
R6050:Celsr1	UTSW	15	85930611	missense	probably benign	0.00
R6117:Celsr1	UTSW	15	85932411	missense	probably benign	0.04
R6178:Celsr1	UTSW	15	85901021	missense	probably benign	0.08
R6186:Celsr1	UTSW	15	85921193	missense	possibly damaging	0.84
R6212:Celsr1	UTSW	15	85916687	missense	probably benign	0.25
R6307:Celsr1	UTSW	15	85928330	missense	probably benign
R6320:Celsr1	UTSW	15	85900959	missense	probably benign	0.13
R6349:Celsr1	UTSW	15	86031684	missense	probably damaging	1.00
R6478:Celsr1	UTSW	15	85925518	missense	probably damaging	0.99
R6504:Celsr1	UTSW	15	85978920	missense	probably benign	0.07
R6607:Celsr1	UTSW	15	85963285	missense	probably benign
R6615:Celsr1	UTSW	15	85902114	critical splice donor site	probably null
R6661:Celsr1	UTSW	15	85918934	missense	probably damaging	1.00
R6722:Celsr1	UTSW	15	85905914	critical splice donor site	probably null
R6743:Celsr1	UTSW	15	85907598	missense	probably damaging	0.96
R6746:Celsr1	UTSW	15	86031495	missense	probably damaging	1.00
R6772:Celsr1	UTSW	15	86030782	missense	probably benign
R6838:Celsr1	UTSW	15	85939194	missense	probably benign
R6886:Celsr1	UTSW	15	86031654	missense	probably benign	0.00
R7030:Celsr1	UTSW	15	85905478	missense	probably damaging	0.99
R7060:Celsr1	UTSW	15	86032655	missense	probably benign	0.07
R7080:Celsr1	UTSW	15	85932451	missense	possibly damaging	0.87
R7325:Celsr1	UTSW	15	86033008	missense	probably damaging	0.99
R7357:Celsr1	UTSW	15	86030514	missense	probably benign	0.00
R7371:Celsr1	UTSW	15	86030674	missense	possibly damaging	0.91
R7446:Celsr1	UTSW	15	85907673	missense	possibly damaging	0.95
R7465:Celsr1	UTSW	15	86033392	missense	probably benign
R7491:Celsr1	UTSW	15	86032518	missense	possibly damaging	0.78
R7639:Celsr1	UTSW	15	85929872	missense	probably benign	0.00
R7685:Celsr1	UTSW	15	85978732	nonsense	probably null
R7741:Celsr1	UTSW	15	85979102	missense	possibly damaging	0.94
R7768:Celsr1	UTSW	15	85932409	missense	probably benign
R7974:Celsr1	UTSW	15	86031030	missense	probably damaging	1.00
R7977:Celsr1	UTSW	15	86032993	missense	probably damaging	1.00
R7987:Celsr1	UTSW	15	86032993	missense	probably damaging	1.00
R8073:Celsr1	UTSW	15	85939155	missense	probably benign	0.00
R8099:Celsr1	UTSW	15	86031600	missense	probably damaging	0.99
R8190:Celsr1	UTSW	15	85902889	missense	probably damaging	0.99
R8210:Celsr1	UTSW	15	85979235	missense	probably benign	0.00
R8289:Celsr1	UTSW	15	86033085	nonsense	probably null
R8290:Celsr1	UTSW	15	86033085	nonsense	probably null
R8292:Celsr1	UTSW	15	85907618	missense	possibly damaging	0.90
R8328:Celsr1	UTSW	15	85922244	missense	probably benign	0.00
R8330:Celsr1	UTSW	15	85932300	missense	probably damaging	0.99
R8333:Celsr1	UTSW	15	86031414	missense	possibly damaging	0.65
R8352:Celsr1	UTSW	15	86033085	nonsense	probably null
R8384:Celsr1	UTSW	15	86033085	nonsense	probably null
R8452:Celsr1	UTSW	15	86033085	nonsense	probably null
R8463:Celsr1	UTSW	15	86030214	missense	probably damaging	1.00
R8479:Celsr1	UTSW	15	86033085	nonsense	probably null
R8480:Celsr1	UTSW	15	86033085	nonsense	probably null
R8493:Celsr1	UTSW	15	85938006	missense	possibly damaging	0.67
R8498:Celsr1	UTSW	15	85939105	missense	probably benign	0.01
R8506:Celsr1	UTSW	15	86033085	nonsense	probably null
R8771:Celsr1	UTSW	15	85903974	missense	probably benign	0.01
R8891:Celsr1	UTSW	15	85937993	missense	probably benign	0.01
R8905:Celsr1	UTSW	15	85904068	intron	probably benign
R8924:Celsr1	UTSW	15	86032470	missense	possibly damaging	0.94
R8979:Celsr1	UTSW	15	85963139	missense	probably damaging	0.96
R9069:Celsr1	UTSW	15	86030571	missense	possibly damaging	0.53
R9115:Celsr1	UTSW	15	85919016	missense	probably damaging	1.00
R9194:Celsr1	UTSW	15	86033085	nonsense	probably null
R9196:Celsr1	UTSW	15	86033085	nonsense	probably null
R9198:Celsr1	UTSW	15	86033085	nonsense	probably null
R9200:Celsr1	UTSW	15	86033085	nonsense	probably null
R9201:Celsr1	UTSW	15	86033085	nonsense	probably null
R9202:Celsr1	UTSW	15	86033085	nonsense	probably null
R9203:Celsr1	UTSW	15	86033085	nonsense	probably null
R9222:Celsr1	UTSW	15	85931270	missense	possibly damaging	0.68
R9236:Celsr1	UTSW	15	86030850	missense	probably damaging	1.00
R9384:Celsr1	UTSW	15	86033085	nonsense	probably null
R9386:Celsr1	UTSW	15	85979030	missense	probably damaging	1.00
R9400:Celsr1	UTSW	15	86033085	nonsense	probably null
R9401:Celsr1	UTSW	15	86033085	nonsense	probably null
R9415:Celsr1	UTSW	15	86033085	nonsense	probably null
R9428:Celsr1	UTSW	15	85931348	missense	possibly damaging	0.64
R9435:Celsr1	UTSW	15	85922334	splice site	probably benign
R9493:Celsr1	UTSW	15	85901145	missense	probably damaging	0.98
R9495:Celsr1	UTSW	15	86033085	nonsense	probably null
R9499:Celsr1	UTSW	15	86033085	nonsense	probably null
R9607:Celsr1	UTSW	15	86031028	missense
R9673:Celsr1	UTSW	15	86033085	nonsense	probably null
Z1176:Celsr1	UTSW	15	85963100	missense	probably damaging	0.96
Z1177:Celsr1	UTSW	15	85978851	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTACACATGAGTTAAGAGTCTGGG -3'
(R):5'- CCTTCCATCAGCCAAGTGTG -3'

Sequencing Primer
(F):5'- GGATGCCTACAAGATGGACCATTAC -3'
(R):5'- TCCATCAGCCAAGTGTGAAGGTC -3'

Posted On

2016-10-05