Incidental Mutation 'R5486:Psmd1'
ID430349
Institutional Source Beutler Lab
Gene Symbol Psmd1
Ensembl Gene ENSMUSG00000026229
Gene Nameproteasome (prosome, macropain) 26S subunit, non-ATPase, 1
SynonymsS1, P112
MMRRC Submission 043047-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock #R5486 (G1)
Quality Score167
Status Not validated
Chromosome1
Chromosomal Location86064387-86139151 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 86137050 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 935 (I935V)
Ref Sequence ENSEMBL: ENSMUSP00000027432 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027432] [ENSMUST00000139715]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027432
AA Change: I935V

PolyPhen 2 Score 0.588 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000027432
Gene: ENSMUSG00000026229
AA Change: I935V

DomainStartEndE-ValueType
Pfam:PC_rep 441 474 5.1e-9 PFAM
Pfam:PC_rep 476 510 8.4e-8 PFAM
Pfam:PC_rep 511 545 1.1e-7 PFAM
Pfam:HEAT_2 599 693 3.3e-15 PFAM
Pfam:PC_rep 651 685 1.1e-11 PFAM
low complexity region 818 828 N/A INTRINSIC
low complexity region 837 872 N/A INTRINSIC
low complexity region 936 949 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000135197
AA Change: I79V
Predicted Effect probably benign
Transcript: ENSMUST00000139715
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149946
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152184
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.2%
  • 10x: 95.1%
  • 20x: 90.4%
Validation Efficiency
MGI Phenotype FUNCTION: In eukaryotic cells, most proteins in the cytosol and nucleus are degraded via the ubiquitin-proteasome pathway. The 26S proteasome is a self-compartmentalizing protease comprised of approximately 31 different subunits. It contains a barrel-shaped proteolytic core complex (the 20S proteasome), capped at one or both ends by 19S regulatory complexes, which recognize ubiquitinated proteins. Protein degradation by proteasomes is the source of most antigenic peptides presented on MHC class I molecules. This gene encodes a non-ATPase subunit of the 26S proteasome. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930009A15Rik G T 10: 115,579,905 probably benign Het
Acad8 A T 9: 26,999,495 M1K probably null Het
Adam12 C A 7: 133,907,672 R786S possibly damaging Het
Add3 G A 19: 53,244,387 V604I probably benign Het
Alpk2 A T 18: 65,294,354 probably null Het
Ano3 T C 2: 110,745,870 D102G probably damaging Het
Bdp1 T C 13: 100,098,510 Y192C probably damaging Het
Bod1l A T 5: 41,807,181 D2693E possibly damaging Het
Ccdc7a T C 8: 128,985,403 N284D probably damaging Het
Clic6 A G 16: 92,529,852 probably null Het
Cln5 T C 14: 103,076,194 I294T probably damaging Het
Cmklr1 C G 5: 113,614,929 D4H possibly damaging Het
Cyp2d9 T A 15: 82,452,578 W43R probably damaging Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Erlec1 A T 11: 30,935,047 H413Q probably damaging Het
Fam168a T A 7: 100,834,169 M203K probably damaging Het
Fat2 A T 11: 55,253,681 S4122R probably benign Het
Fgd4 A T 16: 16,475,037 L272Q probably damaging Het
Hpcal4 A G 4: 123,190,764 K162R probably benign Het
Iars T A 13: 49,709,573 probably null Het
Lbr A G 1: 181,818,838 probably null Het
Lrp2 T C 2: 69,437,465 I4259V probably benign Het
Mcm3 C T 1: 20,814,894 G189S probably damaging Het
Nr1d2 A G 14: 18,206,860 V137A possibly damaging Het
Olfr646 C A 7: 104,106,498 T73N probably damaging Het
Olfr665 T A 7: 104,880,961 C85S probably benign Het
Olfr853 A G 9: 19,537,294 V212A probably benign Het
Pim3 T C 15: 88,863,222 V97A possibly damaging Het
Piwil2 T C 14: 70,401,431 N479S probably benign Het
Pld3 C A 7: 27,533,731 W365L probably damaging Het
Plk3 C A 4: 117,130,403 E412* probably null Het
Sh2b2 A G 5: 136,232,090 S91P probably benign Het
Skor2 A G 18: 76,858,700 N39S unknown Het
Slc22a22 A G 15: 57,263,451 V55A probably damaging Het
Smg7 A G 1: 152,846,176 S595P probably damaging Het
Snrnp200 C T 2: 127,233,066 P1520S possibly damaging Het
Taar7a T A 10: 23,992,458 T342S probably benign Het
Tecpr2 A T 12: 110,933,015 I606F probably benign Het
Tex19.2 A T 11: 121,117,478 M48K probably benign Het
Thoc1 A G 18: 9,992,204 T511A probably benign Het
Trpc2 GTGTCCTA GTGTCCTATGTCCTA 7: 102,095,213 probably null Het
Ubr5 C A 15: 38,008,739 A1077S probably benign Het
Wdr95 A T 5: 149,596,330 R571* probably null Het
Other mutations in Psmd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00772:Psmd1 APN 1 86090198 splice site probably benign
IGL02410:Psmd1 APN 1 86077437 missense probably damaging 0.97
IGL02455:Psmd1 APN 1 86078580 missense probably damaging 0.97
IGL03015:Psmd1 APN 1 86128192 missense probably damaging 0.97
IGL03100:Psmd1 APN 1 86118521 missense possibly damaging 0.68
Rickety UTSW 1 86070628 critical splice donor site probably null
PIT4480001:Psmd1 UTSW 1 86128238 missense probably damaging 0.99
R0027:Psmd1 UTSW 1 86094265 splice site probably benign
R0115:Psmd1 UTSW 1 86083271 missense possibly damaging 0.89
R0201:Psmd1 UTSW 1 86118616 missense probably benign 0.11
R0206:Psmd1 UTSW 1 86133741 missense possibly damaging 0.94
R0208:Psmd1 UTSW 1 86133741 missense possibly damaging 0.94
R0255:Psmd1 UTSW 1 86078582 missense probably damaging 1.00
R0486:Psmd1 UTSW 1 86094290 missense probably damaging 0.99
R0675:Psmd1 UTSW 1 86082039 missense probably benign 0.03
R0790:Psmd1 UTSW 1 86077450 missense possibly damaging 0.94
R1565:Psmd1 UTSW 1 86091997 splice site probably benign
R1721:Psmd1 UTSW 1 86071845 missense probably damaging 0.99
R2010:Psmd1 UTSW 1 86075997 missense probably damaging 0.96
R2098:Psmd1 UTSW 1 86082101 splice site probably null
R2118:Psmd1 UTSW 1 86078700 missense possibly damaging 0.94
R2119:Psmd1 UTSW 1 86078700 missense possibly damaging 0.94
R2120:Psmd1 UTSW 1 86078700 missense possibly damaging 0.94
R2122:Psmd1 UTSW 1 86078700 missense possibly damaging 0.94
R2504:Psmd1 UTSW 1 86089997 missense possibly damaging 0.91
R3810:Psmd1 UTSW 1 86132715 missense probably damaging 0.99
R3811:Psmd1 UTSW 1 86132715 missense probably damaging 0.99
R3978:Psmd1 UTSW 1 86128187 missense probably benign 0.05
R4131:Psmd1 UTSW 1 86078700 missense probably damaging 0.98
R4360:Psmd1 UTSW 1 86133737 missense probably damaging 0.97
R4386:Psmd1 UTSW 1 86128192 missense possibly damaging 0.93
R4402:Psmd1 UTSW 1 86075951 missense possibly damaging 0.59
R4591:Psmd1 UTSW 1 86128204 missense probably benign 0.05
R4783:Psmd1 UTSW 1 86078712 missense probably damaging 0.97
R4824:Psmd1 UTSW 1 86137098 missense probably benign 0.08
R4937:Psmd1 UTSW 1 86083225 missense probably damaging 0.98
R5443:Psmd1 UTSW 1 86090183 missense probably damaging 0.99
R5979:Psmd1 UTSW 1 86090053 missense possibly damaging 0.92
R6033:Psmd1 UTSW 1 86137095 missense probably damaging 1.00
R6425:Psmd1 UTSW 1 86070628 critical splice donor site probably null
R7467:Psmd1 UTSW 1 86116633 missense probably damaging 0.99
R8257:Psmd1 UTSW 1 86078623 missense probably damaging 0.99
Z1177:Psmd1 UTSW 1 86083168 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CTCACTTAACGAGCACCTGC -3'
(R):5'- CAGTCGCTCAGAAAAGAAGTGC -3'

Sequencing Primer
(F):5'- CTCTAGAGAGCAGAGCAGAGCAC -3'
(R):5'- CTGTTTGGGTAGACTGGAGCAAAG -3'
Posted On2016-10-05