Incidental Mutation 'R5486:Smg7'
List |< first << previous [record 36 of 44] next >> last >|
ID430350
Institutional Source Beutler Lab
Gene Symbol Smg7
Ensembl Gene ENSMUSG00000042772
Gene NameSmg-7 homolog, nonsense mediated mRNA decay factor (C. elegans)
Synonyms9430023P16Rik
MMRRC Submission 043047-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.930) question?
Stock #R5486 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location152836995-152902646 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 152846176 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 595 (S595P)
Ref Sequence ENSEMBL: ENSMUSP00000107467 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043560] [ENSMUST00000073441] [ENSMUST00000111836]
Predicted Effect probably benign
Transcript: ENSMUST00000043560
AA Change: S603P

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000041241
Gene: ENSMUSG00000042772
AA Change: S603P

DomainStartEndE-ValueType
Pfam:EST1 63 177 3.4e-30 PFAM
Pfam:EST1_DNA_bind 179 438 3.3e-64 PFAM
low complexity region 457 465 N/A INTRINSIC
low complexity region 615 633 N/A INTRINSIC
low complexity region 682 710 N/A INTRINSIC
low complexity region 711 729 N/A INTRINSIC
low complexity region 874 898 N/A INTRINSIC
low complexity region 906 922 N/A INTRINSIC
low complexity region 931 947 N/A INTRINSIC
low complexity region 1008 1034 N/A INTRINSIC
low complexity region 1126 1140 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000073441
AA Change: S641P

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000073144
Gene: ENSMUSG00000042772
AA Change: S641P

DomainStartEndE-ValueType
Pfam:EST1 52 172 2.3e-26 PFAM
Pfam:EST1_DNA_bind 171 430 3.6e-66 PFAM
low complexity region 449 457 N/A INTRINSIC
low complexity region 653 671 N/A INTRINSIC
low complexity region 720 748 N/A INTRINSIC
low complexity region 749 767 N/A INTRINSIC
low complexity region 919 935 N/A INTRINSIC
low complexity region 996 1022 N/A INTRINSIC
low complexity region 1114 1128 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111836
AA Change: S595P

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000107467
Gene: ENSMUSG00000042772
AA Change: S595P

DomainStartEndE-ValueType
Pfam:EST1 52 172 2.3e-26 PFAM
Pfam:EST1_DNA_bind 171 430 3.7e-66 PFAM
low complexity region 449 457 N/A INTRINSIC
low complexity region 607 625 N/A INTRINSIC
low complexity region 674 702 N/A INTRINSIC
low complexity region 703 721 N/A INTRINSIC
low complexity region 866 890 N/A INTRINSIC
low complexity region 898 914 N/A INTRINSIC
low complexity region 923 939 N/A INTRINSIC
low complexity region 1000 1026 N/A INTRINSIC
low complexity region 1118 1132 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186692
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186900
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188937
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.2%
  • 10x: 95.1%
  • 20x: 90.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is essential for nonsense-mediated mRNA decay (NMD); a process whereby transcripts with premature termination codons are targeted for rapid degradation by a mRNA decay complex. The mRNA decay complex consists, in part, of this protein along with proteins SMG5 and UPF1. The N-terminal domain of this protein is thought to mediate its association with SMG5 or UPF1 while the C-terminal domain interacts with the mRNA decay complex. This protein may therefore couple changes in UPF1 phosphorylation state to the degradation of NMD-candidate transcripts. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930009A15Rik G T 10: 115,579,905 probably benign Het
Acad8 A T 9: 26,999,495 M1K probably null Het
Adam12 C A 7: 133,907,672 R786S possibly damaging Het
Add3 G A 19: 53,244,387 V604I probably benign Het
Alpk2 A T 18: 65,294,354 probably null Het
Ano3 T C 2: 110,745,870 D102G probably damaging Het
Bdp1 T C 13: 100,098,510 Y192C probably damaging Het
Bod1l A T 5: 41,807,181 D2693E possibly damaging Het
Ccdc7a T C 8: 128,985,403 N284D probably damaging Het
Clic6 A G 16: 92,529,852 probably null Het
Cln5 T C 14: 103,076,194 I294T probably damaging Het
Cmklr1 C G 5: 113,614,929 D4H possibly damaging Het
Cyp2d9 T A 15: 82,452,578 W43R probably damaging Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Erlec1 A T 11: 30,935,047 H413Q probably damaging Het
Fam168a T A 7: 100,834,169 M203K probably damaging Het
Fat2 A T 11: 55,253,681 S4122R probably benign Het
Fgd4 A T 16: 16,475,037 L272Q probably damaging Het
Hpcal4 A G 4: 123,190,764 K162R probably benign Het
Iars T A 13: 49,709,573 probably null Het
Lbr A G 1: 181,818,838 probably null Het
Lrp2 T C 2: 69,437,465 I4259V probably benign Het
Mcm3 C T 1: 20,814,894 G189S probably damaging Het
Nr1d2 A G 14: 18,206,860 V137A possibly damaging Het
Olfr646 C A 7: 104,106,498 T73N probably damaging Het
Olfr665 T A 7: 104,880,961 C85S probably benign Het
Olfr853 A G 9: 19,537,294 V212A probably benign Het
Pim3 T C 15: 88,863,222 V97A possibly damaging Het
Piwil2 T C 14: 70,401,431 N479S probably benign Het
Pld3 C A 7: 27,533,731 W365L probably damaging Het
Plk3 C A 4: 117,130,403 E412* probably null Het
Psmd1 A G 1: 86,137,050 I935V possibly damaging Het
Sh2b2 A G 5: 136,232,090 S91P probably benign Het
Skor2 A G 18: 76,858,700 N39S unknown Het
Slc22a22 A G 15: 57,263,451 V55A probably damaging Het
Snrnp200 C T 2: 127,233,066 P1520S possibly damaging Het
Taar7a T A 10: 23,992,458 T342S probably benign Het
Tecpr2 A T 12: 110,933,015 I606F probably benign Het
Tex19.2 A T 11: 121,117,478 M48K probably benign Het
Thoc1 A G 18: 9,992,204 T511A probably benign Het
Trpc2 GTGTCCTA GTGTCCTATGTCCTA 7: 102,095,213 probably null Het
Ubr5 C A 15: 38,008,739 A1077S probably benign Het
Wdr95 A T 5: 149,596,330 R571* probably null Het
Other mutations in Smg7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01751:Smg7 APN 1 152844061 missense possibly damaging 0.68
IGL02320:Smg7 APN 1 152868337 missense possibly damaging 0.49
IGL02336:Smg7 APN 1 152843279 missense probably benign
IGL02680:Smg7 APN 1 152845394 missense probably benign 0.15
IGL03232:Smg7 APN 1 152840156 missense probably damaging 1.00
chill UTSW 1 152840136 unclassified probably null
R0322:Smg7 UTSW 1 152849873 critical splice donor site probably null
R0540:Smg7 UTSW 1 152855962 missense probably benign 0.00
R0685:Smg7 UTSW 1 152866648 missense probably damaging 1.00
R0707:Smg7 UTSW 1 152870757 splice site probably null
R1109:Smg7 UTSW 1 152845583 missense probably damaging 1.00
R1118:Smg7 UTSW 1 152866575 splice site probably benign
R1119:Smg7 UTSW 1 152866575 splice site probably benign
R1458:Smg7 UTSW 1 152855843 splice site probably null
R1759:Smg7 UTSW 1 152848846 missense probably benign 0.20
R1846:Smg7 UTSW 1 152848850 missense probably damaging 1.00
R2015:Smg7 UTSW 1 152860508 missense probably damaging 1.00
R2155:Smg7 UTSW 1 152840313 missense possibly damaging 0.49
R2199:Smg7 UTSW 1 152854328 missense probably damaging 1.00
R2234:Smg7 UTSW 1 152868313 missense probably damaging 1.00
R2235:Smg7 UTSW 1 152868313 missense probably damaging 1.00
R3861:Smg7 UTSW 1 152852598 missense probably null 1.00
R4597:Smg7 UTSW 1 152840301 critical splice donor site probably null
R4672:Smg7 UTSW 1 152845413 missense probably damaging 1.00
R4851:Smg7 UTSW 1 152844269 missense probably benign 0.00
R5607:Smg7 UTSW 1 152843234 missense probably damaging 0.98
R6131:Smg7 UTSW 1 152845211 critical splice donor site probably null
R6396:Smg7 UTSW 1 152848600 missense probably benign 0.33
R6401:Smg7 UTSW 1 152840136 unclassified probably null
R6905:Smg7 UTSW 1 152850006 splice site probably null
R6961:Smg7 UTSW 1 152841583 nonsense probably null
R7051:Smg7 UTSW 1 152848850 missense probably damaging 1.00
R7124:Smg7 UTSW 1 152878080 missense probably benign 0.01
R7146:Smg7 UTSW 1 152861825 missense probably benign 0.34
R7573:Smg7 UTSW 1 152859489 missense probably damaging 1.00
R7578:Smg7 UTSW 1 152845430 missense probably damaging 1.00
R7621:Smg7 UTSW 1 152841544 missense possibly damaging 0.95
R7956:Smg7 UTSW 1 152844202 missense probably benign 0.02
R8167:Smg7 UTSW 1 152844372 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- ACCATTAGGGAGGCTTTATAGTTCAG -3'
(R):5'- TGCCTGTGGGTATGAGCTAC -3'

Sequencing Primer
(F):5'- TAGTTCAGCTTAGGAACACTGCC -3'
(R):5'- GAGCTACCTCACTTGTAAACAAATG -3'
Posted On2016-10-05