Incidental Mutation 'R5486:Ano3'
ID430354
Institutional Source Beutler Lab
Gene Symbol Ano3
Ensembl Gene ENSMUSG00000074968
Gene Nameanoctamin 3
SynonymsTmem16c, B230324K02Rik
MMRRC Submission 043047-MU
Accession Numbers

Genbank: NM_001081556, NM_001128103; MGI: 3613666

Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R5486 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location110655201-110950923 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 110745870 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 102 (D102G)
Ref Sequence ENSEMBL: ENSMUSP00000122387 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099623] [ENSMUST00000140777]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099623
AA Change: D446G

PolyPhen 2 Score 0.684 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000097219
Gene: ENSMUSG00000074968
AA Change: D446G

DomainStartEndE-ValueType
Pfam:Anoct_dimer 156 381 2.9e-70 PFAM
Pfam:Anoctamin 384 950 4.4e-138 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000111019
SMART Domains Protein: ENSMUSP00000106648
Gene: ENSMUSG00000074968

DomainStartEndE-ValueType
Pfam:Anoctamin 384 627 6.3e-60 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000140777
AA Change: D102G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000122387
Gene: ENSMUSG00000074968
AA Change: D102G

DomainStartEndE-ValueType
Pfam:Anoctamin 40 141 5.7e-24 PFAM
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.2%
  • 10x: 95.1%
  • 20x: 90.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the TMEM16 family of predicted membrane proteins, that are also known as anoctamins. While little is known about the function of this gene, mutations in this gene have been associated with some cases of autosomal dominant craniocervical dystonia. Cells from individuals with a mutation in this gene exhibited abnormalities in endoplasmic reticulum-dependent calcium signaling. Studies in rat show that the rat ortholog of this protein interacts with, and modulates the activity of a sodium-activated potassium channel. Deletion of this gene caused increased pain sensitivity in the rat model system. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930009A15Rik G T 10: 115,579,905 probably benign Het
Acad8 A T 9: 26,999,495 M1K probably null Het
Adam12 C A 7: 133,907,672 R786S possibly damaging Het
Add3 G A 19: 53,244,387 V604I probably benign Het
Alpk2 A T 18: 65,294,354 probably null Het
Bdp1 T C 13: 100,098,510 Y192C probably damaging Het
Bod1l A T 5: 41,807,181 D2693E possibly damaging Het
Ccdc7a T C 8: 128,985,403 N284D probably damaging Het
Clic6 A G 16: 92,529,852 probably null Het
Cln5 T C 14: 103,076,194 I294T probably damaging Het
Cmklr1 C G 5: 113,614,929 D4H possibly damaging Het
Cyp2d9 T A 15: 82,452,578 W43R probably damaging Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Erlec1 A T 11: 30,935,047 H413Q probably damaging Het
Fam168a T A 7: 100,834,169 M203K probably damaging Het
Fat2 A T 11: 55,253,681 S4122R probably benign Het
Fgd4 A T 16: 16,475,037 L272Q probably damaging Het
Hpcal4 A G 4: 123,190,764 K162R probably benign Het
Iars T A 13: 49,709,573 probably null Het
Lbr A G 1: 181,818,838 probably null Het
Lrp2 T C 2: 69,437,465 I4259V probably benign Het
Mcm3 C T 1: 20,814,894 G189S probably damaging Het
Nr1d2 A G 14: 18,206,860 V137A possibly damaging Het
Olfr646 C A 7: 104,106,498 T73N probably damaging Het
Olfr665 T A 7: 104,880,961 C85S probably benign Het
Olfr853 A G 9: 19,537,294 V212A probably benign Het
Pim3 T C 15: 88,863,222 V97A possibly damaging Het
Piwil2 T C 14: 70,401,431 N479S probably benign Het
Pld3 C A 7: 27,533,731 W365L probably damaging Het
Plk3 C A 4: 117,130,403 E412* probably null Het
Psmd1 A G 1: 86,137,050 I935V possibly damaging Het
Sh2b2 A G 5: 136,232,090 S91P probably benign Het
Skor2 A G 18: 76,858,700 N39S unknown Het
Slc22a22 A G 15: 57,263,451 V55A probably damaging Het
Smg7 A G 1: 152,846,176 S595P probably damaging Het
Snrnp200 C T 2: 127,233,066 P1520S possibly damaging Het
Taar7a T A 10: 23,992,458 T342S probably benign Het
Tecpr2 A T 12: 110,933,015 I606F probably benign Het
Tex19.2 A T 11: 121,117,478 M48K probably benign Het
Thoc1 A G 18: 9,992,204 T511A probably benign Het
Trpc2 GTGTCCTA GTGTCCTATGTCCTA 7: 102,095,213 probably null Het
Ubr5 C A 15: 38,008,739 A1077S probably benign Het
Wdr95 A T 5: 149,596,330 R571* probably null Het
Other mutations in Ano3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Ano3 APN 2 110771050 splice site probably benign
IGL01066:Ano3 APN 2 110661445 missense probably null 0.00
IGL01696:Ano3 APN 2 110667737 missense probably damaging 1.00
IGL01729:Ano3 APN 2 110781394 splice site probably null
IGL01785:Ano3 APN 2 110682715 missense probably damaging 1.00
IGL01786:Ano3 APN 2 110682715 missense probably damaging 1.00
IGL01992:Ano3 APN 2 110658219 missense probably damaging 1.00
IGL02098:Ano3 APN 2 110666441 nonsense probably null
IGL02333:Ano3 APN 2 110697199 splice site probably benign
IGL02346:Ano3 APN 2 110770926 splice site probably benign
IGL02352:Ano3 APN 2 110884943 nonsense probably null
IGL02359:Ano3 APN 2 110884943 nonsense probably null
IGL02544:Ano3 APN 2 110658249 missense possibly damaging 0.79
IGL02750:Ano3 APN 2 110665984 splice site probably benign
IGL02861:Ano3 APN 2 110738812 missense probably damaging 1.00
IGL02948:Ano3 APN 2 110697018 splice site probably benign
IGL03327:Ano3 APN 2 110697178 missense possibly damaging 0.62
3-1:Ano3 UTSW 2 110697124 missense probably damaging 1.00
IGL02988:Ano3 UTSW 2 110775010 missense probably damaging 1.00
IGL03147:Ano3 UTSW 2 110697418 missense probably damaging 1.00
R0349:Ano3 UTSW 2 110661487 missense probably damaging 1.00
R0426:Ano3 UTSW 2 110661174 missense probably damaging 1.00
R0523:Ano3 UTSW 2 110884855 missense probably benign 0.13
R0557:Ano3 UTSW 2 110862952 splice site probably null
R0611:Ano3 UTSW 2 110885001 missense possibly damaging 0.93
R0891:Ano3 UTSW 2 110697976 missense probably benign 0.03
R1459:Ano3 UTSW 2 110880829 missense probably benign 0.00
R1460:Ano3 UTSW 2 110682758 missense probably damaging 0.97
R1773:Ano3 UTSW 2 110761455 missense probably damaging 1.00
R1874:Ano3 UTSW 2 110884872 missense probably benign 0.00
R1919:Ano3 UTSW 2 110885007 missense probably benign
R2185:Ano3 UTSW 2 110775045 missense probably benign 0.01
R2280:Ano3 UTSW 2 110682759 missense probably benign 0.22
R2281:Ano3 UTSW 2 110682759 missense probably benign 0.22
R2348:Ano3 UTSW 2 110783743 missense possibly damaging 0.82
R2425:Ano3 UTSW 2 110862843 missense probably benign
R2697:Ano3 UTSW 2 110794960 missense possibly damaging 0.79
R3888:Ano3 UTSW 2 110885000 missense probably damaging 0.99
R3923:Ano3 UTSW 2 110770959 missense probably damaging 1.00
R4352:Ano3 UTSW 2 110745894 missense possibly damaging 0.74
R4447:Ano3 UTSW 2 110761578 unclassified probably null
R4790:Ano3 UTSW 2 110884919 missense probably benign
R4832:Ano3 UTSW 2 110667722 missense probably damaging 1.00
R4916:Ano3 UTSW 2 110771020 missense possibly damaging 0.74
R5113:Ano3 UTSW 2 110661480 missense possibly damaging 0.61
R5498:Ano3 UTSW 2 110697103 missense possibly damaging 0.68
R5589:Ano3 UTSW 2 110884995 missense probably damaging 0.99
R5627:Ano3 UTSW 2 110756953 missense possibly damaging 0.61
R5741:Ano3 UTSW 2 110658273 missense probably benign 0.11
R5767:Ano3 UTSW 2 110661271 missense probably damaging 1.00
R5883:Ano3 UTSW 2 110880864 missense probably null 0.15
R5899:Ano3 UTSW 2 110862887 missense probably benign 0.39
R5916:Ano3 UTSW 2 110681836 missense probably benign 0.29
R6158:Ano3 UTSW 2 110665875 missense probably damaging 1.00
R6315:Ano3 UTSW 2 110697039 missense probably damaging 1.00
R6401:Ano3 UTSW 2 110775114 missense probably benign 0.01
R6481:Ano3 UTSW 2 110795027 missense probably benign 0.16
R6482:Ano3 UTSW 2 110697055 missense probably damaging 1.00
R6587:Ano3 UTSW 2 110797904 intron probably null
R6811:Ano3 UTSW 2 110880867 missense probably benign 0.03
R7048:Ano3 UTSW 2 110682771 nonsense probably null
R7145:Ano3 UTSW 2 110862860 missense probably benign 0.31
R7207:Ano3 UTSW 2 110781423 missense probably damaging 0.96
R7215:Ano3 UTSW 2 110665932 missense probably damaging 1.00
R7366:Ano3 UTSW 2 110757067 missense probably damaging 1.00
R7371:Ano3 UTSW 2 110884849 critical splice donor site probably null
R7568:Ano3 UTSW 2 110950293 start gained probably benign
R7636:Ano3 UTSW 2 110682703 nonsense probably null
R7888:Ano3 UTSW 2 110666428 missense probably damaging 1.00
R7971:Ano3 UTSW 2 110666428 missense probably damaging 1.00
R8024:Ano3 UTSW 2 110667783 missense probably damaging 0.99
R8074:Ano3 UTSW 2 110950232 start gained probably benign
R8111:Ano3 UTSW 2 110783713 missense possibly damaging 0.95
R8177:Ano3 UTSW 2 110666456 missense probably damaging 1.00
R8297:Ano3 UTSW 2 110661271 missense probably damaging 1.00
RF012:Ano3 UTSW 2 110697523 missense possibly damaging 0.83
RF013:Ano3 UTSW 2 110697036 missense probably benign 0.30
X0058:Ano3 UTSW 2 110697418 missense probably damaging 1.00
Z1088:Ano3 UTSW 2 110745847 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACTGATTTTACCCAGTTGTCAATG -3'
(R):5'- AGGCCATCATCTAACTCTATCCTG -3'

Sequencing Primer
(F):5'- GAATTTACCGGGTAACTTTTCACTG -3'
(R):5'- GCTAAAACAGGGGTTCAC -3'
Posted On2016-10-05