Incidental Mutation 'R5486:Hpcal4'
List |< first << previous [record 19 of 44] next >> last >|
ID430357
Institutional Source Beutler Lab
Gene Symbol Hpcal4
Ensembl Gene ENSMUSG00000046093
Gene Namehippocalcin-like 4
Synonyms
MMRRC Submission 043047-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5486 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location123183227-123194701 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 123190764 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 162 (K162R)
Ref Sequence ENSEMBL: ENSMUSP00000101853 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059667] [ENSMUST00000106246] [ENSMUST00000126995] [ENSMUST00000152194]
Predicted Effect probably benign
Transcript: ENSMUST00000059667
AA Change: K162R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000051487
Gene: ENSMUSG00000046093
AA Change: K162R

DomainStartEndE-ValueType
EFh 64 92 3.01e-5 SMART
EFh 100 128 4.88e-5 SMART
EFh 150 178 1.95e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106246
AA Change: K162R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000101853
Gene: ENSMUSG00000046093
AA Change: K162R

DomainStartEndE-ValueType
EFh 64 92 3.01e-5 SMART
EFh 100 128 4.88e-5 SMART
EFh 150 178 1.95e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126995
Predicted Effect probably benign
Transcript: ENSMUST00000152194
SMART Domains Protein: ENSMUSP00000120066
Gene: ENSMUSG00000046093

DomainStartEndE-ValueType
EFh 64 92 3.01e-5 SMART
EFh 100 128 4.88e-5 SMART
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.2%
  • 10x: 95.1%
  • 20x: 90.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is highly similar to human hippocalcin protein and hippocalcin like-1 protein. It also has similarity to rat neural visinin-like Ca2+-binding protein-type 1 and 2 proteins. This encoded protein may be involved in the calcium-dependent regulation of rhodopsin phosphorylation. The transcript of this gene has multiple polyadenylation sites. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2013]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930009A15Rik G T 10: 115,579,905 probably benign Het
Acad8 A T 9: 26,999,495 M1K probably null Het
Adam12 C A 7: 133,907,672 R786S possibly damaging Het
Add3 G A 19: 53,244,387 V604I probably benign Het
Alpk2 A T 18: 65,294,354 probably null Het
Ano3 T C 2: 110,745,870 D102G probably damaging Het
Bdp1 T C 13: 100,098,510 Y192C probably damaging Het
Bod1l A T 5: 41,807,181 D2693E possibly damaging Het
Ccdc7a T C 8: 128,985,403 N284D probably damaging Het
Clic6 A G 16: 92,529,852 probably null Het
Cln5 T C 14: 103,076,194 I294T probably damaging Het
Cmklr1 C G 5: 113,614,929 D4H possibly damaging Het
Cyp2d9 T A 15: 82,452,578 W43R probably damaging Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Erlec1 A T 11: 30,935,047 H413Q probably damaging Het
Fam168a T A 7: 100,834,169 M203K probably damaging Het
Fat2 A T 11: 55,253,681 S4122R probably benign Het
Fgd4 A T 16: 16,475,037 L272Q probably damaging Het
Iars T A 13: 49,709,573 probably null Het
Lbr A G 1: 181,818,838 probably null Het
Lrp2 T C 2: 69,437,465 I4259V probably benign Het
Mcm3 C T 1: 20,814,894 G189S probably damaging Het
Nr1d2 A G 14: 18,206,860 V137A possibly damaging Het
Olfr646 C A 7: 104,106,498 T73N probably damaging Het
Olfr665 T A 7: 104,880,961 C85S probably benign Het
Olfr853 A G 9: 19,537,294 V212A probably benign Het
Pim3 T C 15: 88,863,222 V97A possibly damaging Het
Piwil2 T C 14: 70,401,431 N479S probably benign Het
Pld3 C A 7: 27,533,731 W365L probably damaging Het
Plk3 C A 4: 117,130,403 E412* probably null Het
Psmd1 A G 1: 86,137,050 I935V possibly damaging Het
Sh2b2 A G 5: 136,232,090 S91P probably benign Het
Skor2 A G 18: 76,858,700 N39S unknown Het
Slc22a22 A G 15: 57,263,451 V55A probably damaging Het
Smg7 A G 1: 152,846,176 S595P probably damaging Het
Snrnp200 C T 2: 127,233,066 P1520S possibly damaging Het
Taar7a T A 10: 23,992,458 T342S probably benign Het
Tecpr2 A T 12: 110,933,015 I606F probably benign Het
Tex19.2 A T 11: 121,117,478 M48K probably benign Het
Thoc1 A G 18: 9,992,204 T511A probably benign Het
Trpc2 GTGTCCTA GTGTCCTATGTCCTA 7: 102,095,213 probably null Het
Ubr5 C A 15: 38,008,739 A1077S probably benign Het
Wdr95 A T 5: 149,596,330 R571* probably null Het
Other mutations in Hpcal4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01386:Hpcal4 APN 4 123189242 critical splice donor site probably null
R0551:Hpcal4 UTSW 4 123189055 missense possibly damaging 0.95
R1669:Hpcal4 UTSW 4 123189076 missense probably damaging 1.00
R1723:Hpcal4 UTSW 4 123190739 missense probably benign 0.00
R4798:Hpcal4 UTSW 4 123190698 missense possibly damaging 0.68
R6076:Hpcal4 UTSW 4 123190721 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AAAGCCAGTCTTAACGGCCC -3'
(R):5'- TCGCTCGAGGAACTTGACTG -3'

Sequencing Primer
(F):5'- GCCAGTCTTAACGGCCCTACTC -3'
(R):5'- CTCGAGGAACTTGACTGAGGAG -3'
Posted On2016-10-05