Incidental Mutation 'R5486:Sh2b2'
ID430359
Institutional Source Beutler Lab
Gene Symbol Sh2b2
Ensembl Gene ENSMUSG00000005057
Gene NameSH2B adaptor protein 2
SynonymsAps
MMRRC Submission 043047-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.936) question?
Stock #R5486 (G1)
Quality Score165
Status Not validated
Chromosome5
Chromosomal Location136218147-136246556 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 136232090 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 91 (S91P)
Ref Sequence ENSEMBL: ENSMUSP00000142728 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005188] [ENSMUST00000196245] [ENSMUST00000196397] [ENSMUST00000196447]
Predicted Effect probably benign
Transcript: ENSMUST00000005188
AA Change: S91P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000005188
Gene: ENSMUSG00000005057
AA Change: S91P

DomainStartEndE-ValueType
low complexity region 6 16 N/A INTRINSIC
Pfam:Phe_ZIP 17 73 9.3e-22 PFAM
Blast:PH 95 168 2e-21 BLAST
low complexity region 169 180 N/A INTRINSIC
PH 187 301 4.97e-9 SMART
low complexity region 340 350 N/A INTRINSIC
low complexity region 388 404 N/A INTRINSIC
SH2 407 492 1.38e-21 SMART
low complexity region 509 525 N/A INTRINSIC
low complexity region 548 576 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196245
Predicted Effect probably benign
Transcript: ENSMUST00000196397
AA Change: S91P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000142398
Gene: ENSMUSG00000005057
AA Change: S91P

DomainStartEndE-ValueType
Pfam:Phe_ZIP 16 74 1.5e-30 PFAM
Blast:PH 95 168 2e-21 BLAST
low complexity region 169 180 N/A INTRINSIC
PH 187 301 4.97e-9 SMART
low complexity region 340 350 N/A INTRINSIC
low complexity region 388 404 N/A INTRINSIC
SH2 407 492 1.38e-21 SMART
low complexity region 509 525 N/A INTRINSIC
low complexity region 548 576 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196447
AA Change: S91P

PolyPhen 2 Score 0.100 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000142728
Gene: ENSMUSG00000005057
AA Change: S91P

DomainStartEndE-ValueType
Pfam:Phe_ZIP 16 74 9.1e-28 PFAM
Blast:PH 95 168 9e-22 BLAST
low complexity region 169 180 N/A INTRINSIC
PH 187 301 2.2e-11 SMART
low complexity region 340 350 N/A INTRINSIC
low complexity region 406 417 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.2%
  • 10x: 95.1%
  • 20x: 90.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is expressed in B lymphocytes and contains pleckstrin homology and src homology 2 (SH2) domains. In Burkitt's lymphoma cell lines, it is tyrosine-phosphorylated in response to B cell receptor stimulation. Because it binds Shc independent of stimulation and Grb2 after stimulation, it appears to play a role in signal transduction from the receptor to the Shc/Grb2 pathway. [provided by RefSeq, Jun 2009]
PHENOTYPE: Inactivation of this gene results in increased insulin sensitivity accompanied by hypoinsulinemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930009A15Rik G T 10: 115,579,905 probably benign Het
Acad8 A T 9: 26,999,495 M1K probably null Het
Adam12 C A 7: 133,907,672 R786S possibly damaging Het
Add3 G A 19: 53,244,387 V604I probably benign Het
Alpk2 A T 18: 65,294,354 probably null Het
Ano3 T C 2: 110,745,870 D102G probably damaging Het
Bdp1 T C 13: 100,098,510 Y192C probably damaging Het
Bod1l A T 5: 41,807,181 D2693E possibly damaging Het
Ccdc7a T C 8: 128,985,403 N284D probably damaging Het
Clic6 A G 16: 92,529,852 probably null Het
Cln5 T C 14: 103,076,194 I294T probably damaging Het
Cmklr1 C G 5: 113,614,929 D4H possibly damaging Het
Cyp2d9 T A 15: 82,452,578 W43R probably damaging Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Erlec1 A T 11: 30,935,047 H413Q probably damaging Het
Fam168a T A 7: 100,834,169 M203K probably damaging Het
Fat2 A T 11: 55,253,681 S4122R probably benign Het
Fgd4 A T 16: 16,475,037 L272Q probably damaging Het
Hpcal4 A G 4: 123,190,764 K162R probably benign Het
Iars T A 13: 49,709,573 probably null Het
Lbr A G 1: 181,818,838 probably null Het
Lrp2 T C 2: 69,437,465 I4259V probably benign Het
Mcm3 C T 1: 20,814,894 G189S probably damaging Het
Nr1d2 A G 14: 18,206,860 V137A possibly damaging Het
Olfr646 C A 7: 104,106,498 T73N probably damaging Het
Olfr665 T A 7: 104,880,961 C85S probably benign Het
Olfr853 A G 9: 19,537,294 V212A probably benign Het
Pim3 T C 15: 88,863,222 V97A possibly damaging Het
Piwil2 T C 14: 70,401,431 N479S probably benign Het
Pld3 C A 7: 27,533,731 W365L probably damaging Het
Plk3 C A 4: 117,130,403 E412* probably null Het
Psmd1 A G 1: 86,137,050 I935V possibly damaging Het
Skor2 A G 18: 76,858,700 N39S unknown Het
Slc22a22 A G 15: 57,263,451 V55A probably damaging Het
Smg7 A G 1: 152,846,176 S595P probably damaging Het
Snrnp200 C T 2: 127,233,066 P1520S possibly damaging Het
Taar7a T A 10: 23,992,458 T342S probably benign Het
Tecpr2 A T 12: 110,933,015 I606F probably benign Het
Tex19.2 A T 11: 121,117,478 M48K probably benign Het
Thoc1 A G 18: 9,992,204 T511A probably benign Het
Trpc2 GTGTCCTA GTGTCCTATGTCCTA 7: 102,095,213 probably null Het
Ubr5 C A 15: 38,008,739 A1077S probably benign Het
Wdr95 A T 5: 149,596,330 R571* probably null Het
Other mutations in Sh2b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Sh2b2 APN 5 136224419 missense probably damaging 1.00
IGL01456:Sh2b2 APN 5 136224467 missense probably damaging 0.98
IGL01612:Sh2b2 APN 5 136231802 missense probably benign 0.02
IGL02798:Sh2b2 APN 5 136221963 missense probably damaging 1.00
R0492:Sh2b2 UTSW 5 136232263 missense probably damaging 1.00
R0539:Sh2b2 UTSW 5 136225301 splice site probably benign
R0707:Sh2b2 UTSW 5 136232263 missense probably damaging 1.00
R1569:Sh2b2 UTSW 5 136231735 missense possibly damaging 0.89
R1777:Sh2b2 UTSW 5 136227422 missense probably damaging 1.00
R2088:Sh2b2 UTSW 5 136232114 missense possibly damaging 0.87
R3702:Sh2b2 UTSW 5 136224233 missense probably damaging 0.99
R4223:Sh2b2 UTSW 5 136219053 missense possibly damaging 0.91
R4597:Sh2b2 UTSW 5 136231762 missense probably damaging 0.99
R4683:Sh2b2 UTSW 5 136231720 missense probably damaging 1.00
R4766:Sh2b2 UTSW 5 136231957 missense probably damaging 0.99
R6060:Sh2b2 UTSW 5 136232355 missense possibly damaging 0.72
R6322:Sh2b2 UTSW 5 136224188 missense probably damaging 0.99
R7020:Sh2b2 UTSW 5 136224299 missense possibly damaging 0.69
R7034:Sh2b2 UTSW 5 136218885 missense probably benign 0.18
R7036:Sh2b2 UTSW 5 136218885 missense probably benign 0.18
R7615:Sh2b2 UTSW 5 136219657 missense probably damaging 1.00
R7715:Sh2b2 UTSW 5 136219035 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- GTCCATTTGTCACGAGGCTC -3'
(R):5'- CACACAAGTTCTGCCGCTTC -3'

Sequencing Primer
(F):5'- ATTTGTCACGAGGCTCCGACG -3'
(R):5'- CGCTTCCTTCGGGACAAC -3'
Posted On2016-10-05