Incidental Mutation 'R5486:Pld3'
ID430361
Institutional Source Beutler Lab
Gene Symbol Pld3
Ensembl Gene ENSMUSG00000003363
Gene Namephospholipase D family, member 3
SynonymsSam-9
MMRRC Submission 043047-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5486 (G1)
Quality Score178
Status Not validated
Chromosome7
Chromosomal Location27532000-27553218 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 27533731 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Leucine at position 365 (W365L)
Ref Sequence ENSEMBL: ENSMUSP00000112942 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037134] [ENSMUST00000108353] [ENSMUST00000117095] [ENSMUST00000117611]
Predicted Effect probably benign
Transcript: ENSMUST00000037134
SMART Domains Protein: ENSMUSP00000043175
Gene: ENSMUSG00000040424

DomainStartEndE-ValueType
SCOP:d1howa_ 1 142 8e-12 SMART
Blast:S_TKc 1 143 8e-99 BLAST
PDB:3ANR|D 1 155 1e-12 PDB
low complexity region 192 206 N/A INTRINSIC
low complexity region 389 399 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108353
SMART Domains Protein: ENSMUSP00000103990
Gene: ENSMUSG00000040424

DomainStartEndE-ValueType
S_TKc 11 347 9.31e-74 SMART
low complexity region 396 410 N/A INTRINSIC
low complexity region 593 603 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000117095
AA Change: W365L

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113820
Gene: ENSMUSG00000003363
AA Change: W365L

DomainStartEndE-ValueType
low complexity region 25 36 N/A INTRINSIC
transmembrane domain 38 60 N/A INTRINSIC
PLDc 194 221 9.25e-10 SMART
Pfam:PLDc_3 224 401 1.6e-43 PFAM
PLDc 409 435 1.19e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000117611
AA Change: W365L

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000112942
Gene: ENSMUSG00000003363
AA Change: W365L

DomainStartEndE-ValueType
low complexity region 25 36 N/A INTRINSIC
transmembrane domain 38 60 N/A INTRINSIC
PLDc 194 221 9.25e-10 SMART
low complexity region 285 297 N/A INTRINSIC
PLDc 409 435 1.19e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142981
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155287
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.2%
  • 10x: 95.1%
  • 20x: 90.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the phospholipase D (PLD) family of enzymes that catalyze the hydrolysis of membrane phospholipids. The encoded protein is a single-pass type II membrane protein and contains two PLD phosphodiesterase domains. This protein influences processing of amyloid-beta precursor protein. Mutations in this gene are associated with Alzheimer disease risk. Alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Apr 2014]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930009A15Rik G T 10: 115,579,905 probably benign Het
Acad8 A T 9: 26,999,495 M1K probably null Het
Adam12 C A 7: 133,907,672 R786S possibly damaging Het
Add3 G A 19: 53,244,387 V604I probably benign Het
Alpk2 A T 18: 65,294,354 probably null Het
Ano3 T C 2: 110,745,870 D102G probably damaging Het
Bdp1 T C 13: 100,098,510 Y192C probably damaging Het
Bod1l A T 5: 41,807,181 D2693E possibly damaging Het
Ccdc7a T C 8: 128,985,403 N284D probably damaging Het
Clic6 A G 16: 92,529,852 probably null Het
Cln5 T C 14: 103,076,194 I294T probably damaging Het
Cmklr1 C G 5: 113,614,929 D4H possibly damaging Het
Cyp2d9 T A 15: 82,452,578 W43R probably damaging Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Erlec1 A T 11: 30,935,047 H413Q probably damaging Het
Fam168a T A 7: 100,834,169 M203K probably damaging Het
Fat2 A T 11: 55,253,681 S4122R probably benign Het
Fgd4 A T 16: 16,475,037 L272Q probably damaging Het
Hpcal4 A G 4: 123,190,764 K162R probably benign Het
Iars T A 13: 49,709,573 probably null Het
Lbr A G 1: 181,818,838 probably null Het
Lrp2 T C 2: 69,437,465 I4259V probably benign Het
Mcm3 C T 1: 20,814,894 G189S probably damaging Het
Nr1d2 A G 14: 18,206,860 V137A possibly damaging Het
Olfr646 C A 7: 104,106,498 T73N probably damaging Het
Olfr665 T A 7: 104,880,961 C85S probably benign Het
Olfr853 A G 9: 19,537,294 V212A probably benign Het
Pim3 T C 15: 88,863,222 V97A possibly damaging Het
Piwil2 T C 14: 70,401,431 N479S probably benign Het
Plk3 C A 4: 117,130,403 E412* probably null Het
Psmd1 A G 1: 86,137,050 I935V possibly damaging Het
Sh2b2 A G 5: 136,232,090 S91P probably benign Het
Skor2 A G 18: 76,858,700 N39S unknown Het
Slc22a22 A G 15: 57,263,451 V55A probably damaging Het
Smg7 A G 1: 152,846,176 S595P probably damaging Het
Snrnp200 C T 2: 127,233,066 P1520S possibly damaging Het
Taar7a T A 10: 23,992,458 T342S probably benign Het
Tecpr2 A T 12: 110,933,015 I606F probably benign Het
Tex19.2 A T 11: 121,117,478 M48K probably benign Het
Thoc1 A G 18: 9,992,204 T511A probably benign Het
Trpc2 GTGTCCTA GTGTCCTATGTCCTA 7: 102,095,213 probably null Het
Ubr5 C A 15: 38,008,739 A1077S probably benign Het
Wdr95 A T 5: 149,596,330 R571* probably null Het
Other mutations in Pld3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01474:Pld3 APN 7 27532619 missense probably damaging 1.00
R0624:Pld3 UTSW 7 27539575 missense possibly damaging 0.94
R1384:Pld3 UTSW 7 27537657 missense probably benign 0.00
R1845:Pld3 UTSW 7 27539452 missense probably benign 0.01
R2235:Pld3 UTSW 7 27541107 missense probably benign 0.00
R3106:Pld3 UTSW 7 27535787 critical splice donor site probably null
R5141:Pld3 UTSW 7 27533795 missense probably damaging 1.00
R5518:Pld3 UTSW 7 27532371 missense probably damaging 1.00
R5868:Pld3 UTSW 7 27537668 missense probably benign 0.00
R6446:Pld3 UTSW 7 27537731 missense probably damaging 1.00
R6591:Pld3 UTSW 7 27532316 missense probably benign 0.00
R6691:Pld3 UTSW 7 27532316 missense probably benign 0.00
R6823:Pld3 UTSW 7 27535897 missense probably damaging 1.00
R7162:Pld3 UTSW 7 27532474 missense probably damaging 1.00
R8150:Pld3 UTSW 7 27532661 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGATAAACCTCTGTCTGTACCC -3'
(R):5'- ATGCAGAGAAACCCTGTCTC -3'

Sequencing Primer
(F):5'- TCACGGCTGCATACTCTGG -3'
(R):5'- TGCAGAGAAACCCTGTCTCAAAAG -3'
Posted On2016-10-05