Incidental Mutation 'R5486:Fam168a'
ID430363
Institutional Source Beutler Lab
Gene Symbol Fam168a
Ensembl Gene ENSMUSG00000029461
Gene Namefamily with sequence similarity 168, member A
SynonymsB930006L02Rik, 2610030B18Rik
MMRRC Submission 043047-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.147) question?
Stock #R5486 (G1)
Quality Score166
Status Not validated
Chromosome7
Chromosomal Location100706635-100841656 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 100834169 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 203 (M203K)
Ref Sequence ENSEMBL: ENSMUSP00000102657 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049053] [ENSMUST00000107042] [ENSMUST00000207564] [ENSMUST00000207875] [ENSMUST00000208013] [ENSMUST00000216021]
Predicted Effect probably benign
Transcript: ENSMUST00000049053
AA Change: M194K

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000038233
Gene: ENSMUSG00000029461
AA Change: M194K

DomainStartEndE-ValueType
Pfam:TCRP1 1 235 1.4e-112 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107042
AA Change: M203K

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000102657
Gene: ENSMUSG00000029461
AA Change: M203K

DomainStartEndE-ValueType
Pfam:TCRP1 1 235 1.7e-105 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000207564
Predicted Effect probably benign
Transcript: ENSMUST00000207875
AA Change: M194K

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect possibly damaging
Transcript: ENSMUST00000208013
AA Change: M219K

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
Predicted Effect probably benign
Transcript: ENSMUST00000216021
AA Change: M194K

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.2%
  • 10x: 95.1%
  • 20x: 90.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930009A15Rik G T 10: 115,579,905 probably benign Het
Acad8 A T 9: 26,999,495 M1K probably null Het
Adam12 C A 7: 133,907,672 R786S possibly damaging Het
Add3 G A 19: 53,244,387 V604I probably benign Het
Alpk2 A T 18: 65,294,354 probably null Het
Ano3 T C 2: 110,745,870 D102G probably damaging Het
Bdp1 T C 13: 100,098,510 Y192C probably damaging Het
Bod1l A T 5: 41,807,181 D2693E possibly damaging Het
Ccdc7a T C 8: 128,985,403 N284D probably damaging Het
Clic6 A G 16: 92,529,852 probably null Het
Cln5 T C 14: 103,076,194 I294T probably damaging Het
Cmklr1 C G 5: 113,614,929 D4H possibly damaging Het
Cyp2d9 T A 15: 82,452,578 W43R probably damaging Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Erlec1 A T 11: 30,935,047 H413Q probably damaging Het
Fat2 A T 11: 55,253,681 S4122R probably benign Het
Fgd4 A T 16: 16,475,037 L272Q probably damaging Het
Hpcal4 A G 4: 123,190,764 K162R probably benign Het
Iars T A 13: 49,709,573 probably null Het
Lbr A G 1: 181,818,838 probably null Het
Lrp2 T C 2: 69,437,465 I4259V probably benign Het
Mcm3 C T 1: 20,814,894 G189S probably damaging Het
Nr1d2 A G 14: 18,206,860 V137A possibly damaging Het
Olfr646 C A 7: 104,106,498 T73N probably damaging Het
Olfr665 T A 7: 104,880,961 C85S probably benign Het
Olfr853 A G 9: 19,537,294 V212A probably benign Het
Pim3 T C 15: 88,863,222 V97A possibly damaging Het
Piwil2 T C 14: 70,401,431 N479S probably benign Het
Pld3 C A 7: 27,533,731 W365L probably damaging Het
Plk3 C A 4: 117,130,403 E412* probably null Het
Psmd1 A G 1: 86,137,050 I935V possibly damaging Het
Sh2b2 A G 5: 136,232,090 S91P probably benign Het
Skor2 A G 18: 76,858,700 N39S unknown Het
Slc22a22 A G 15: 57,263,451 V55A probably damaging Het
Smg7 A G 1: 152,846,176 S595P probably damaging Het
Snrnp200 C T 2: 127,233,066 P1520S possibly damaging Het
Taar7a T A 10: 23,992,458 T342S probably benign Het
Tecpr2 A T 12: 110,933,015 I606F probably benign Het
Tex19.2 A T 11: 121,117,478 M48K probably benign Het
Thoc1 A G 18: 9,992,204 T511A probably benign Het
Trpc2 GTGTCCTA GTGTCCTATGTCCTA 7: 102,095,213 probably null Het
Ubr5 C A 15: 38,008,739 A1077S probably benign Het
Wdr95 A T 5: 149,596,330 R571* probably null Het
Other mutations in Fam168a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01658:Fam168a APN 7 100812973 missense possibly damaging 0.94
IGL02502:Fam168a APN 7 100824210 missense probably damaging 1.00
IGL03048:Fam168a UTSW 7 100835338 missense probably damaging 0.99
R0069:Fam168a UTSW 7 100835411 missense probably benign 0.40
R2509:Fam168a UTSW 7 100834184 critical splice donor site probably null
R3715:Fam168a UTSW 7 100824225 missense probably damaging 0.99
R4518:Fam168a UTSW 7 100834040 missense probably damaging 1.00
R5463:Fam168a UTSW 7 100835395 missense probably benign 0.00
R6123:Fam168a UTSW 7 100824150 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGCCATGTAACCTTAGCCTCTC -3'
(R):5'- AATATGCCCATCTTGTGTGCC -3'

Sequencing Primer
(F):5'- CTTCCCAGGGAGCCTACTAC -3'
(R):5'- ATCCCTCTGAATACTTGAGACTCTAC -3'
Posted On2016-10-05