Incidental Mutation 'R5486:Trpc2'
ID430364
Institutional Source Beutler Lab
Gene Symbol Trpc2
Ensembl Gene ENSMUSG00000100254
Gene Nametransient receptor potential cation channel, subfamily C, member 2
Synonymstrp2, mTrp2, TRPC2a, TRPC2b, 3010009O07Rik, Trrp2
MMRRC Submission 043047-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5486 (G1)
Quality Score217
Status Not validated
Chromosome7
Chromosomal Location102083116-102096396 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) GTGTCCTA to GTGTCCTATGTCCTA at 102095213 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000116934 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084843] [ENSMUST00000094128] [ENSMUST00000094129] [ENSMUST00000106934] [ENSMUST00000106935] [ENSMUST00000106937] [ENSMUST00000123372] [ENSMUST00000124189] [ENSMUST00000139104]
Predicted Effect probably null
Transcript: ENSMUST00000084843
SMART Domains Protein: ENSMUSP00000081903
Gene: ENSMUSG00000070425

DomainStartEndE-ValueType
Pfam:XRCC1_N 1 150 1.4e-54 PFAM
low complexity region 254 267 N/A INTRINSIC
low complexity region 275 280 N/A INTRINSIC
low complexity region 297 311 N/A INTRINSIC
low complexity region 345 362 N/A INTRINSIC
low complexity region 403 415 N/A INTRINSIC
low complexity region 416 428 N/A INTRINSIC
ANK 439 469 1.58e3 SMART
low complexity region 484 496 N/A INTRINSIC
ANK 522 551 1.74e0 SMART
Pfam:TRP_2 557 619 1e-24 PFAM
Pfam:Ion_trans 716 1024 1.7e-24 PFAM
Pfam:PKD_channel 774 1019 2.4e-12 PFAM
low complexity region 1070 1081 N/A INTRINSIC
low complexity region 1093 1104 N/A INTRINSIC
coiled coil region 1122 1162 N/A INTRINSIC
low complexity region 1220 1236 N/A INTRINSIC
low complexity region 1247 1263 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000094128
SMART Domains Protein: ENSMUSP00000091678
Gene: ENSMUSG00000070424

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:ART 29 255 3.6e-96 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000094129
SMART Domains Protein: ENSMUSP00000091679
Gene: ENSMUSG00000070425

DomainStartEndE-ValueType
Pfam:XRCC1_N 1 152 1.2e-27 PFAM
low complexity region 254 267 N/A INTRINSIC
low complexity region 275 280 N/A INTRINSIC
low complexity region 297 311 N/A INTRINSIC
low complexity region 345 362 N/A INTRINSIC
low complexity region 403 415 N/A INTRINSIC
low complexity region 416 428 N/A INTRINSIC
ANK 439 469 1.58e3 SMART
low complexity region 484 496 N/A INTRINSIC
ANK 522 551 1.74e0 SMART
Pfam:TRP_2 557 619 2.8e-28 PFAM
transmembrane domain 719 741 N/A INTRINSIC
Pfam:PKD_channel 772 1019 3.8e-12 PFAM
Pfam:Ion_trans 796 1012 3.9e-31 PFAM
low complexity region 1070 1081 N/A INTRINSIC
low complexity region 1093 1104 N/A INTRINSIC
coiled coil region 1122 1162 N/A INTRINSIC
low complexity region 1220 1236 N/A INTRINSIC
low complexity region 1247 1263 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106934
SMART Domains Protein: ENSMUSP00000102547
Gene: ENSMUSG00000070424

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:ART 29 117 3.7e-29 PFAM
Pfam:ART 114 157 6.5e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106935
SMART Domains Protein: ENSMUSP00000102548
Gene: ENSMUSG00000070424

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:ART 29 146 2.1e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106937
SMART Domains Protein: ENSMUSP00000102550
Gene: ENSMUSG00000070424

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:ART 29 255 1.9e-96 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123372
SMART Domains Protein: ENSMUSP00000121068
Gene: ENSMUSG00000070425

DomainStartEndE-ValueType
Pfam:XRCC1_N 1 152 5.2e-29 PFAM
low complexity region 254 267 N/A INTRINSIC
low complexity region 275 280 N/A INTRINSIC
low complexity region 297 311 N/A INTRINSIC
internal_repeat_1 324 345 2.69e-6 PROSPERO
low complexity region 346 379 N/A INTRINSIC
internal_repeat_1 380 401 2.69e-6 PROSPERO
Predicted Effect probably null
Transcript: ENSMUST00000124189
SMART Domains Protein: ENSMUSP00000116934
Gene: ENSMUSG00000100254

DomainStartEndE-ValueType
low complexity region 29 41 N/A INTRINSIC
low complexity region 42 54 N/A INTRINSIC
ANK 65 95 1.58e3 SMART
low complexity region 110 122 N/A INTRINSIC
ANK 148 177 1.74e0 SMART
Pfam:TRP_2 183 245 9.1e-29 PFAM
transmembrane domain 345 367 N/A INTRINSIC
Pfam:PKD_channel 398 645 1.4e-12 PFAM
Pfam:Ion_trans 422 638 1e-31 PFAM
low complexity region 696 707 N/A INTRINSIC
low complexity region 719 730 N/A INTRINSIC
coiled coil region 748 788 N/A INTRINSIC
low complexity region 846 862 N/A INTRINSIC
low complexity region 873 889 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139104
SMART Domains Protein: ENSMUSP00000122430
Gene: ENSMUSG00000070425

DomainStartEndE-ValueType
Pfam:XRCC1_N 1 62 3.5e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155078
SMART Domains Protein: ENSMUSP00000123466
Gene: ENSMUSG00000070425

DomainStartEndE-ValueType
Pfam:XRCC1_N 1 62 4.4e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211553
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.2%
  • 10x: 95.1%
  • 20x: 90.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice exhibit altered sexual and social behavior, including intermale mounting and a lack of aggressive behavior in the presence of invading males. Homozygotes for another allele show increased triglyceride levels in both males and femalesand increased cholesterol in males. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930009A15Rik G T 10: 115,579,905 probably benign Het
Acad8 A T 9: 26,999,495 M1K probably null Het
Adam12 C A 7: 133,907,672 R786S possibly damaging Het
Add3 G A 19: 53,244,387 V604I probably benign Het
Alpk2 A T 18: 65,294,354 probably null Het
Ano3 T C 2: 110,745,870 D102G probably damaging Het
Bdp1 T C 13: 100,098,510 Y192C probably damaging Het
Bod1l A T 5: 41,807,181 D2693E possibly damaging Het
Ccdc7a T C 8: 128,985,403 N284D probably damaging Het
Clic6 A G 16: 92,529,852 probably null Het
Cln5 T C 14: 103,076,194 I294T probably damaging Het
Cmklr1 C G 5: 113,614,929 D4H possibly damaging Het
Cyp2d9 T A 15: 82,452,578 W43R probably damaging Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Erlec1 A T 11: 30,935,047 H413Q probably damaging Het
Fam168a T A 7: 100,834,169 M203K probably damaging Het
Fat2 A T 11: 55,253,681 S4122R probably benign Het
Fgd4 A T 16: 16,475,037 L272Q probably damaging Het
Hpcal4 A G 4: 123,190,764 K162R probably benign Het
Iars T A 13: 49,709,573 probably null Het
Lbr A G 1: 181,818,838 probably null Het
Lrp2 T C 2: 69,437,465 I4259V probably benign Het
Mcm3 C T 1: 20,814,894 G189S probably damaging Het
Nr1d2 A G 14: 18,206,860 V137A possibly damaging Het
Olfr646 C A 7: 104,106,498 T73N probably damaging Het
Olfr665 T A 7: 104,880,961 C85S probably benign Het
Olfr853 A G 9: 19,537,294 V212A probably benign Het
Pim3 T C 15: 88,863,222 V97A possibly damaging Het
Piwil2 T C 14: 70,401,431 N479S probably benign Het
Pld3 C A 7: 27,533,731 W365L probably damaging Het
Plk3 C A 4: 117,130,403 E412* probably null Het
Psmd1 A G 1: 86,137,050 I935V possibly damaging Het
Sh2b2 A G 5: 136,232,090 S91P probably benign Het
Skor2 A G 18: 76,858,700 N39S unknown Het
Slc22a22 A G 15: 57,263,451 V55A probably damaging Het
Smg7 A G 1: 152,846,176 S595P probably damaging Het
Snrnp200 C T 2: 127,233,066 P1520S possibly damaging Het
Taar7a T A 10: 23,992,458 T342S probably benign Het
Tecpr2 A T 12: 110,933,015 I606F probably benign Het
Tex19.2 A T 11: 121,117,478 M48K probably benign Het
Thoc1 A G 18: 9,992,204 T511A probably benign Het
Ubr5 C A 15: 38,008,739 A1077S probably benign Het
Wdr95 A T 5: 149,596,330 R571* probably null Het
Other mutations in Trpc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0443:Trpc2 UTSW 7 102093520 splice site probably benign
R0601:Trpc2 UTSW 7 102084365 missense possibly damaging 0.53
R1303:Trpc2 UTSW 7 102088161 missense probably damaging 1.00
R1493:Trpc2 UTSW 7 102090576 missense probably damaging 0.97
R1579:Trpc2 UTSW 7 102084240 missense probably damaging 0.99
R1829:Trpc2 UTSW 7 102084119 missense probably damaging 1.00
R2010:Trpc2 UTSW 7 102094573 missense probably benign
R3103:Trpc2 UTSW 7 102095234 missense possibly damaging 0.74
R3738:Trpc2 UTSW 7 102084504 missense probably damaging 1.00
R3739:Trpc2 UTSW 7 102084504 missense probably damaging 1.00
R3938:Trpc2 UTSW 7 102093574 missense probably damaging 1.00
R3945:Trpc2 UTSW 7 102088279 missense possibly damaging 0.52
R3951:Trpc2 UTSW 7 102093574 missense probably damaging 1.00
R3970:Trpc2 UTSW 7 102084324 missense probably damaging 1.00
R4035:Trpc2 UTSW 7 102084504 missense probably damaging 1.00
R4234:Trpc2 UTSW 7 102088135 missense possibly damaging 0.52
R4329:Trpc2 UTSW 7 102087520 missense probably damaging 1.00
R4531:Trpc2 UTSW 7 102095998 missense probably damaging 1.00
R4857:Trpc2 UTSW 7 102083969 missense probably benign 0.18
R5058:Trpc2 UTSW 7 102089109 missense probably damaging 1.00
R5093:Trpc2 UTSW 7 102095183 missense probably benign
R5485:Trpc2 UTSW 7 102095213 frame shift probably null
R5487:Trpc2 UTSW 7 102095213 frame shift probably null
R5782:Trpc2 UTSW 7 102083979 missense possibly damaging 0.85
R6379:Trpc2 UTSW 7 102096091 nonsense probably null
R6572:Trpc2 UTSW 7 102090006 missense probably damaging 1.00
R6674:Trpc2 UTSW 7 102096057 missense probably benign 0.36
R7513:Trpc2 UTSW 7 102090068 missense probably damaging 0.99
R8209:Trpc2 UTSW 7 102088275 missense possibly damaging 0.93
R8226:Trpc2 UTSW 7 102088275 missense possibly damaging 0.93
RF020:Trpc2 UTSW 7 102096226 missense unknown
Z1176:Trpc2 UTSW 7 102095297 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCAGTGCTGCAGTTCTTCAG -3'
(R):5'- GGGACTAGAGCCTAATGCAG -3'

Sequencing Primer
(F):5'- CTGCAGTTCTTCAGGGGTC -3'
(R):5'- CTAGAGCCTAATGCAGAAGTGTG -3'
Posted On2016-10-05