Incidental Mutation 'R5486:Olfr646'
ID430365
Institutional Source Beutler Lab
Gene Symbol Olfr646
Ensembl Gene ENSMUSG00000073931
Gene Nameolfactory receptor 646
SynonymsGA_x6K02T2PBJ9-6841330-6842268, MOR33-2
MMRRC Submission 043047-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.132) question?
Stock #R5486 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location104104873-104109766 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 104106498 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Asparagine at position 73 (T73N)
Ref Sequence ENSEMBL: ENSMUSP00000149102 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098182] [ENSMUST00000138055] [ENSMUST00000214099]
Predicted Effect probably damaging
Transcript: ENSMUST00000098182
AA Change: T73N

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000095784
Gene: ENSMUSG00000073931
AA Change: T73N

DomainStartEndE-ValueType
Pfam:7tm_4 28 307 1.9e-109 PFAM
Pfam:7TM_GPCR_Srsx 32 225 6.1e-10 PFAM
Pfam:7tm_1 38 290 3.3e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138055
SMART Domains Protein: ENSMUSP00000139240
Gene: ENSMUSG00000109824

DomainStartEndE-ValueType
transmembrane domain 29 51 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000214099
AA Change: T73N

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214291
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.2%
  • 10x: 95.1%
  • 20x: 90.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930009A15Rik G T 10: 115,579,905 probably benign Het
Acad8 A T 9: 26,999,495 M1K probably null Het
Adam12 C A 7: 133,907,672 R786S possibly damaging Het
Add3 G A 19: 53,244,387 V604I probably benign Het
Alpk2 A T 18: 65,294,354 probably null Het
Ano3 T C 2: 110,745,870 D102G probably damaging Het
Bdp1 T C 13: 100,098,510 Y192C probably damaging Het
Bod1l A T 5: 41,807,181 D2693E possibly damaging Het
Ccdc7a T C 8: 128,985,403 N284D probably damaging Het
Clic6 A G 16: 92,529,852 probably null Het
Cln5 T C 14: 103,076,194 I294T probably damaging Het
Cmklr1 C G 5: 113,614,929 D4H possibly damaging Het
Cyp2d9 T A 15: 82,452,578 W43R probably damaging Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Erlec1 A T 11: 30,935,047 H413Q probably damaging Het
Fam168a T A 7: 100,834,169 M203K probably damaging Het
Fat2 A T 11: 55,253,681 S4122R probably benign Het
Fgd4 A T 16: 16,475,037 L272Q probably damaging Het
Hpcal4 A G 4: 123,190,764 K162R probably benign Het
Iars T A 13: 49,709,573 probably null Het
Lbr A G 1: 181,818,838 probably null Het
Lrp2 T C 2: 69,437,465 I4259V probably benign Het
Mcm3 C T 1: 20,814,894 G189S probably damaging Het
Nr1d2 A G 14: 18,206,860 V137A possibly damaging Het
Olfr665 T A 7: 104,880,961 C85S probably benign Het
Olfr853 A G 9: 19,537,294 V212A probably benign Het
Pim3 T C 15: 88,863,222 V97A possibly damaging Het
Piwil2 T C 14: 70,401,431 N479S probably benign Het
Pld3 C A 7: 27,533,731 W365L probably damaging Het
Plk3 C A 4: 117,130,403 E412* probably null Het
Psmd1 A G 1: 86,137,050 I935V possibly damaging Het
Sh2b2 A G 5: 136,232,090 S91P probably benign Het
Skor2 A G 18: 76,858,700 N39S unknown Het
Slc22a22 A G 15: 57,263,451 V55A probably damaging Het
Smg7 A G 1: 152,846,176 S595P probably damaging Het
Snrnp200 C T 2: 127,233,066 P1520S possibly damaging Het
Taar7a T A 10: 23,992,458 T342S probably benign Het
Tecpr2 A T 12: 110,933,015 I606F probably benign Het
Tex19.2 A T 11: 121,117,478 M48K probably benign Het
Thoc1 A G 18: 9,992,204 T511A probably benign Het
Trpc2 GTGTCCTA GTGTCCTATGTCCTA 7: 102,095,213 probably null Het
Ubr5 C A 15: 38,008,739 A1077S probably benign Het
Wdr95 A T 5: 149,596,330 R571* probably null Het
Other mutations in Olfr646
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01779:Olfr646 APN 7 104106633 missense probably damaging 1.00
IGL02454:Olfr646 APN 7 104106612 missense probably damaging 0.96
IGL02588:Olfr646 APN 7 104107053 missense possibly damaging 0.94
IGL02961:Olfr646 APN 7 104107150 nonsense probably null
IGL03092:Olfr646 APN 7 104106647 missense probably damaging 0.99
PIT4402001:Olfr646 UTSW 7 104106450 missense probably damaging 1.00
R0006:Olfr646 UTSW 7 104106320 missense probably benign 0.00
R0109:Olfr646 UTSW 7 104106605 missense probably damaging 1.00
R0109:Olfr646 UTSW 7 104106605 missense probably damaging 1.00
R0601:Olfr646 UTSW 7 104107142 missense possibly damaging 0.83
R0732:Olfr646 UTSW 7 104106294 missense probably damaging 1.00
R1320:Olfr646 UTSW 7 104106480 missense probably damaging 1.00
R1468:Olfr646 UTSW 7 104106689 missense possibly damaging 0.82
R1468:Olfr646 UTSW 7 104106689 missense possibly damaging 0.82
R1513:Olfr646 UTSW 7 104106464 missense probably benign 0.02
R6110:Olfr646 UTSW 7 104106572 missense probably damaging 1.00
R6497:Olfr646 UTSW 7 104107215 intron probably benign
R6856:Olfr646 UTSW 7 104106791 missense probably benign 0.00
R7766:Olfr646 UTSW 7 104106994 nonsense probably null
R7789:Olfr646 UTSW 7 104106988 missense probably damaging 0.99
R7844:Olfr646 UTSW 7 104106483 missense probably damaging 1.00
R7927:Olfr646 UTSW 7 104106483 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAGCCCTTCGTGTGCCAAG -3'
(R):5'- ATCTCAGTGGGTTGCAGATAG -3'

Sequencing Primer
(F):5'- TTCGTGTGCCAAGACAGAC -3'
(R):5'- GCTACATATCGATCAAAGGCCATGG -3'
Posted On2016-10-05