Incidental Mutation 'R5486:Olfr665'
List |< first << previous [record 26 of 44] next >> last >|
ID430366
Institutional Source Beutler Lab
Gene Symbol Olfr665
Ensembl Gene ENSMUSG00000073917
Gene Nameolfactory receptor 665
SynonymsGA_x6K02T2PBJ9-7509539-7510489, MOR34-7
MMRRC Submission 043047-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R5486 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location104878031-104882906 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 104880961 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 85 (C85S)
Ref Sequence ENSEMBL: ENSMUSP00000150229 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098165] [ENSMUST00000215761] [ENSMUST00000216257] [ENSMUST00000216971]
Predicted Effect probably benign
Transcript: ENSMUST00000098165
AA Change: C85S

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000095768
Gene: ENSMUSG00000073917
AA Change: C85S

DomainStartEndE-ValueType
Pfam:7tm_4 33 313 6.4e-105 PFAM
Pfam:7TM_GPCR_Srsx 37 310 1e-5 PFAM
Pfam:7tm_1 43 295 1.4e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215761
AA Change: C85S

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
Predicted Effect probably benign
Transcript: ENSMUST00000216257
AA Change: C85S

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
Predicted Effect probably benign
Transcript: ENSMUST00000216971
AA Change: C85S

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.2%
  • 10x: 95.1%
  • 20x: 90.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930009A15Rik G T 10: 115,579,905 probably benign Het
Acad8 A T 9: 26,999,495 M1K probably null Het
Adam12 C A 7: 133,907,672 R786S possibly damaging Het
Add3 G A 19: 53,244,387 V604I probably benign Het
Alpk2 A T 18: 65,294,354 probably null Het
Ano3 T C 2: 110,745,870 D102G probably damaging Het
Bdp1 T C 13: 100,098,510 Y192C probably damaging Het
Bod1l A T 5: 41,807,181 D2693E possibly damaging Het
Ccdc7a T C 8: 128,985,403 N284D probably damaging Het
Clic6 A G 16: 92,529,852 probably null Het
Cln5 T C 14: 103,076,194 I294T probably damaging Het
Cmklr1 C G 5: 113,614,929 D4H possibly damaging Het
Cyp2d9 T A 15: 82,452,578 W43R probably damaging Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Erlec1 A T 11: 30,935,047 H413Q probably damaging Het
Fam168a T A 7: 100,834,169 M203K probably damaging Het
Fat2 A T 11: 55,253,681 S4122R probably benign Het
Fgd4 A T 16: 16,475,037 L272Q probably damaging Het
Hpcal4 A G 4: 123,190,764 K162R probably benign Het
Iars T A 13: 49,709,573 probably null Het
Lbr A G 1: 181,818,838 probably null Het
Lrp2 T C 2: 69,437,465 I4259V probably benign Het
Mcm3 C T 1: 20,814,894 G189S probably damaging Het
Nr1d2 A G 14: 18,206,860 V137A possibly damaging Het
Olfr646 C A 7: 104,106,498 T73N probably damaging Het
Olfr853 A G 9: 19,537,294 V212A probably benign Het
Pim3 T C 15: 88,863,222 V97A possibly damaging Het
Piwil2 T C 14: 70,401,431 N479S probably benign Het
Pld3 C A 7: 27,533,731 W365L probably damaging Het
Plk3 C A 4: 117,130,403 E412* probably null Het
Psmd1 A G 1: 86,137,050 I935V possibly damaging Het
Sh2b2 A G 5: 136,232,090 S91P probably benign Het
Skor2 A G 18: 76,858,700 N39S unknown Het
Slc22a22 A G 15: 57,263,451 V55A probably damaging Het
Smg7 A G 1: 152,846,176 S595P probably damaging Het
Snrnp200 C T 2: 127,233,066 P1520S possibly damaging Het
Taar7a T A 10: 23,992,458 T342S probably benign Het
Tecpr2 A T 12: 110,933,015 I606F probably benign Het
Tex19.2 A T 11: 121,117,478 M48K probably benign Het
Thoc1 A G 18: 9,992,204 T511A probably benign Het
Trpc2 GTGTCCTA GTGTCCTATGTCCTA 7: 102,095,213 probably null Het
Ubr5 C A 15: 38,008,739 A1077S probably benign Het
Wdr95 A T 5: 149,596,330 R571* probably null Het
Other mutations in Olfr665
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Olfr665 APN 7 104881517 missense probably benign 0.01
IGL01408:Olfr665 APN 7 104880830 missense probably benign 0.02
IGL02022:Olfr665 APN 7 104880934 missense probably damaging 1.00
R0349:Olfr665 UTSW 7 104880992 missense possibly damaging 0.48
R0585:Olfr665 UTSW 7 104881499 missense probably damaging 1.00
R1518:Olfr665 UTSW 7 104881308 nonsense probably null
R1659:Olfr665 UTSW 7 104881180 missense probably benign 0.00
R1727:Olfr665 UTSW 7 104881514 missense probably benign 0.11
R1762:Olfr665 UTSW 7 104881240 missense probably damaging 0.99
R4052:Olfr665 UTSW 7 104881603 missense probably damaging 0.99
R4208:Olfr665 UTSW 7 104881603 missense probably damaging 0.99
R5513:Olfr665 UTSW 7 104881499 missense probably damaging 1.00
R6148:Olfr665 UTSW 7 104881082 missense possibly damaging 0.84
R6593:Olfr665 UTSW 7 104881433 missense probably damaging 1.00
R7143:Olfr665 UTSW 7 104881186 missense probably damaging 1.00
R7189:Olfr665 UTSW 7 104881141 nonsense probably null
R7413:Olfr665 UTSW 7 104880850 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- AAGCTGCACACATCTGGATC -3'
(R):5'- AGGGACCATGAGTAACACACTTC -3'

Sequencing Primer
(F):5'- GCACACATCTGGATCTCTCTG -3'
(R):5'- AAGTGCTGCCAATCCAATCTTG -3'
Posted On2016-10-05