Mutagenetix > Incidental Mutation

Incidental Mutation 'R5486:Adam12'

430367

Institutional Source

Beutler Lab

Gene Symbol

Adam12

Ensembl Gene

ENSMUSG00000054555

Gene Name

a disintegrin and metallopeptidase domain 12 (meltrin alpha)

Synonyms

Mltna, ADAM12

MMRRC Submission

043047-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.443) question?

Stock #

R5486 (G1)

Quality Score

212

Status

Not validated

Chromosome

Chromosomal Location

133883199-134232146 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 133907672 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Serine at position 786 (R786S)

Ref Sequence

ENSEMBL: ENSMUSP00000065213 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000067680] [ENSMUST00000138363]

AlphaFold

Q61824

Predicted Effect

possibly damaging
Transcript: ENSMUST00000067680
AA Change: R786S

PolyPhen 2 Score 0.752 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000065213
Gene: ENSMUSG00000054555
AA Change: R786S

Domain	Start	End	E-Value	Type
signal peptide	1	31	N/A	INTRINSIC
Pfam:Pep_M12B_propep	35	165	1.1e-27	PFAM
Pfam:Reprolysin_5	210	392	2.1e-24	PFAM
Pfam:Reprolysin_4	210	408	3.8e-16	PFAM
Pfam:Reprolysin	212	414	1.4e-74	PFAM
Pfam:Reprolysin_2	232	404	6e-18	PFAM
Pfam:Reprolysin_3	236	359	1.3e-16	PFAM
DISIN	431	506	4.29e-42	SMART
ACR	507	650	1.75e-67	SMART
transmembrane domain	705	727	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000138363
AA Change: R464S

PolyPhen 2 Score 0.514 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000114874
Gene: ENSMUSG00000054555
AA Change: R464S

Domain	Start	End	E-Value	Type
Pfam:Reprolysin	4	92	4.5e-24	PFAM
Pfam:Reprolysin_2	6	82	2.1e-11	PFAM
Pfam:Reprolysin_5	9	70	2.8e-11	PFAM
Pfam:Reprolysin_4	11	87	8.9e-8	PFAM
DISIN	109	184	4.29e-42	SMART
ACR	185	328	1.75e-67	SMART
transmembrane domain	383	405	N/A	INTRINSIC

Coding Region Coverage

1x: 98.2%
3x: 97.2%
10x: 95.1%
20x: 90.4%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of a disintegrin and metalloprotease (ADAM) family of endoproteases that play important roles in various biological processes including cell signaling, adhesion and migration. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein that localizes to the cell surface. About a third of the mice lacking the encoded protein die before weaning. Overexpression of the encoded protein in a mouse model of Duchenne muscular dystrophy alleviates the muscle pathology by preventing cell necrosis and inflammation. [provided by RefSeq, May 2016]
PHENOTYPE: Homozygous null mice display partial postnatal lethality, decreased brown fat, and impaired formation of neck and interscapular muscles. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A930009A15Rik	G	T	10: 115,579,905		probably benign	Het
Acad8	A	T	9: 26,999,495	M1K	probably null	Het
Add3	G	A	19: 53,244,387	V604I	probably benign	Het
Alpk2	A	T	18: 65,294,354		probably null	Het
Ano3	T	C	2: 110,745,870	D102G	probably damaging	Het
Bdp1	T	C	13: 100,098,510	Y192C	probably damaging	Het
Bod1l	A	T	5: 41,807,181	D2693E	possibly damaging	Het
Ccdc7a	T	C	8: 128,985,403	N284D	probably damaging	Het
Clic6	A	G	16: 92,529,852		probably null	Het
Cln5	T	C	14: 103,076,194	I294T	probably damaging	Het
Cmklr1	C	G	5: 113,614,929	D4H	possibly damaging	Het
Cyp2d9	T	A	15: 82,452,578	W43R	probably damaging	Het
Dnajb12	GC	G	10: 59,892,752		probably null	Het
Erlec1	A	T	11: 30,935,047	H413Q	probably damaging	Het
Fam168a	T	A	7: 100,834,169	M203K	probably damaging	Het
Fat2	A	T	11: 55,253,681	S4122R	probably benign	Het
Fgd4	A	T	16: 16,475,037	L272Q	probably damaging	Het
Hpcal4	A	G	4: 123,190,764	K162R	probably benign	Het
Iars	T	A	13: 49,709,573		probably null	Het
Lbr	A	G	1: 181,818,838		probably null	Het
Lrp2	T	C	2: 69,437,465	I4259V	probably benign	Het
Mcm3	C	T	1: 20,814,894	G189S	probably damaging	Het
Nr1d2	A	G	14: 18,206,860	V137A	possibly damaging	Het
Olfr646	C	A	7: 104,106,498	T73N	probably damaging	Het
Olfr665	T	A	7: 104,880,961	C85S	probably benign	Het
Olfr853	A	G	9: 19,537,294	V212A	probably benign	Het
Pim3	T	C	15: 88,863,222	V97A	possibly damaging	Het
Piwil2	T	C	14: 70,401,431	N479S	probably benign	Het
Pld3	C	A	7: 27,533,731	W365L	probably damaging	Het
Plk3	C	A	4: 117,130,403	E412*	probably null	Het
Psmd1	A	G	1: 86,137,050	I935V	possibly damaging	Het
Sh2b2	A	G	5: 136,232,090	S91P	probably benign	Het
Skor2	A	G	18: 76,858,700	N39S	unknown	Het
Slc22a22	A	G	15: 57,263,451	V55A	probably damaging	Het
Smg7	A	G	1: 152,846,176	S595P	probably damaging	Het
Snrnp200	C	T	2: 127,233,066	P1520S	possibly damaging	Het
Taar7a	T	A	10: 23,992,458	T342S	probably benign	Het
Tecpr2	A	T	12: 110,933,015	I606F	probably benign	Het
Tex19.2	A	T	11: 121,117,478	M48K	probably benign	Het
Thoc1	A	G	18: 9,992,204	T511A	probably benign	Het
Trpc2	GTGTCCTA	GTGTCCTATGTCCTA	7: 102,095,213		probably null	Het
Ubr5	C	A	15: 38,008,739	A1077S	probably benign	Het
Wdr95	A	T	5: 149,596,330	R571*	probably null	Het

Other mutations in Adam12

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00474:Adam12	APN	7	133909881	missense	possibly damaging	0.51
IGL01403:Adam12	APN	7	133919610	missense	probably benign	0.00
IGL01482:Adam12	APN	7	133967848	missense	probably damaging	1.00
IGL01922:Adam12	APN	7	133937472	nonsense	probably null
IGL02397:Adam12	APN	7	133909819	splice site	probably benign
IGL03401:Adam12	APN	7	133916463	missense	probably damaging	1.00
R0122:Adam12	UTSW	7	134012348	missense	probably benign	0.45
R0200:Adam12	UTSW	7	133974416	splice site	probably null
R0463:Adam12	UTSW	7	133974416	splice site	probably null
R0927:Adam12	UTSW	7	133998230	missense	probably damaging	1.00
R1258:Adam12	UTSW	7	133937447	missense	probably damaging	1.00
R1440:Adam12	UTSW	7	133931814	missense	probably benign	0.03
R1483:Adam12	UTSW	7	133930025	missense	probably benign	0.41
R1692:Adam12	UTSW	7	133887944	makesense	probably null
R1797:Adam12	UTSW	7	133967861	missense	probably benign	0.03
R2134:Adam12	UTSW	7	134012288	nonsense	probably null
R2230:Adam12	UTSW	7	133919618	missense	probably damaging	1.00
R2350:Adam12	UTSW	7	133919524	missense	probably damaging	1.00
R2944:Adam12	UTSW	7	133975507	missense	probably null	0.02
R3688:Adam12	UTSW	7	133964796	nonsense	probably null
R3747:Adam12	UTSW	7	134172865	missense	probably damaging	0.96
R3749:Adam12	UTSW	7	134172865	missense	probably damaging	0.96
R3750:Adam12	UTSW	7	134172865	missense	probably damaging	0.96
R4028:Adam12	UTSW	7	133929996	missense	probably damaging	1.00
R4130:Adam12	UTSW	7	133912924	missense	probably damaging	1.00
R4131:Adam12	UTSW	7	133912924	missense	probably damaging	1.00
R4346:Adam12	UTSW	7	133981535	missense	possibly damaging	0.82
R4701:Adam12	UTSW	7	133916462	missense	possibly damaging	0.64
R4887:Adam12	UTSW	7	134172821	missense	possibly damaging	0.74
R5355:Adam12	UTSW	7	133887942	makesense	probably null
R5468:Adam12	UTSW	7	133975473	missense	probably damaging	1.00
R5990:Adam12	UTSW	7	133931736	missense	probably damaging	1.00
R6504:Adam12	UTSW	7	133929984	missense	probably damaging	1.00
R6783:Adam12	UTSW	7	133974397	missense	probably damaging	1.00
R7117:Adam12	UTSW	7	133916462	missense	probably benign	0.00
R7263:Adam12	UTSW	7	133919511	missense	possibly damaging	0.68
R7749:Adam12	UTSW	7	134224813	missense	unknown
R7820:Adam12	UTSW	7	133998188	missense	probably benign	0.00
R7880:Adam12	UTSW	7	133909962	missense	possibly damaging	0.94
R7891:Adam12	UTSW	7	133998232	missense	probably benign	0.00
R8114:Adam12	UTSW	7	133967888	missense	probably damaging	1.00
R8160:Adam12	UTSW	7	133968041	splice site	probably null
R8683:Adam12	UTSW	7	133890200	missense	possibly damaging	0.49
R9236:Adam12	UTSW	7	134012293	missense	probably benign	0.03
R9277:Adam12	UTSW	7	133919832	missense	probably benign	0.00
R9480:Adam12	UTSW	7	134134741	missense	probably damaging	0.98
R9515:Adam12	UTSW	7	133907644	missense	probably benign	0.03
R9599:Adam12	UTSW	7	133964725	missense	probably damaging	0.99
X0057:Adam12	UTSW	7	134012315	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TGAACCCCATTTTAGACAGTCAC -3'
(R):5'- ATTCCAGATTTAGGGGTTGCTTCC -3'

Sequencing Primer
(F):5'- CAGAGCCTGGATTTGAGCTTCATC -3'
(R):5'- GTTGCTTCCTGTAGAATTTTGAAC -3'

Posted On

2016-10-05