Incidental Mutation 'R5486:Olfr853'
ID430369
Institutional Source Beutler Lab
Gene Symbol Olfr853
Ensembl Gene ENSMUSG00000051160
Gene Nameolfactory receptor 853
SynonymsMOR154-1, GA_x6K02T2PVTD-13277703-13276786
MMRRC Submission 043047-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R5486 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location19534202-19541076 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 19537294 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 212 (V212A)
Ref Sequence ENSEMBL: ENSMUSP00000150773 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058296] [ENSMUST00000213834]
Predicted Effect probably benign
Transcript: ENSMUST00000058296
AA Change: V212A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000053262
Gene: ENSMUSG00000051160
AA Change: V212A

DomainStartEndE-ValueType
Pfam:7tm_4 31 305 1.3e-57 PFAM
Pfam:7TM_GPCR_Srsx 35 206 1.7e-7 PFAM
Pfam:7tm_1 41 290 1.1e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212273
Predicted Effect probably benign
Transcript: ENSMUST00000213834
AA Change: V212A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.2%
  • 10x: 95.1%
  • 20x: 90.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930009A15Rik G T 10: 115,579,905 probably benign Het
Acad8 A T 9: 26,999,495 M1K probably null Het
Adam12 C A 7: 133,907,672 R786S possibly damaging Het
Add3 G A 19: 53,244,387 V604I probably benign Het
Alpk2 A T 18: 65,294,354 probably null Het
Ano3 T C 2: 110,745,870 D102G probably damaging Het
Bdp1 T C 13: 100,098,510 Y192C probably damaging Het
Bod1l A T 5: 41,807,181 D2693E possibly damaging Het
Ccdc7a T C 8: 128,985,403 N284D probably damaging Het
Clic6 A G 16: 92,529,852 probably null Het
Cln5 T C 14: 103,076,194 I294T probably damaging Het
Cmklr1 C G 5: 113,614,929 D4H possibly damaging Het
Cyp2d9 T A 15: 82,452,578 W43R probably damaging Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Erlec1 A T 11: 30,935,047 H413Q probably damaging Het
Fam168a T A 7: 100,834,169 M203K probably damaging Het
Fat2 A T 11: 55,253,681 S4122R probably benign Het
Fgd4 A T 16: 16,475,037 L272Q probably damaging Het
Hpcal4 A G 4: 123,190,764 K162R probably benign Het
Iars T A 13: 49,709,573 probably null Het
Lbr A G 1: 181,818,838 probably null Het
Lrp2 T C 2: 69,437,465 I4259V probably benign Het
Mcm3 C T 1: 20,814,894 G189S probably damaging Het
Nr1d2 A G 14: 18,206,860 V137A possibly damaging Het
Olfr646 C A 7: 104,106,498 T73N probably damaging Het
Olfr665 T A 7: 104,880,961 C85S probably benign Het
Pim3 T C 15: 88,863,222 V97A possibly damaging Het
Piwil2 T C 14: 70,401,431 N479S probably benign Het
Pld3 C A 7: 27,533,731 W365L probably damaging Het
Plk3 C A 4: 117,130,403 E412* probably null Het
Psmd1 A G 1: 86,137,050 I935V possibly damaging Het
Sh2b2 A G 5: 136,232,090 S91P probably benign Het
Skor2 A G 18: 76,858,700 N39S unknown Het
Slc22a22 A G 15: 57,263,451 V55A probably damaging Het
Smg7 A G 1: 152,846,176 S595P probably damaging Het
Snrnp200 C T 2: 127,233,066 P1520S possibly damaging Het
Taar7a T A 10: 23,992,458 T342S probably benign Het
Tecpr2 A T 12: 110,933,015 I606F probably benign Het
Tex19.2 A T 11: 121,117,478 M48K probably benign Het
Thoc1 A G 18: 9,992,204 T511A probably benign Het
Trpc2 GTGTCCTA GTGTCCTATGTCCTA 7: 102,095,213 probably null Het
Ubr5 C A 15: 38,008,739 A1077S probably benign Het
Wdr95 A T 5: 149,596,330 R571* probably null Het
Other mutations in Olfr853
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02074:Olfr853 APN 9 19537852 missense possibly damaging 0.94
IGL02078:Olfr853 APN 9 19537453 missense probably benign 0.14
IGL02092:Olfr853 APN 9 19537750 missense probably damaging 0.99
IGL02728:Olfr853 APN 9 19537846 missense possibly damaging 0.95
R0245:Olfr853 UTSW 9 19537112 missense probably benign 0.01
R1331:Olfr853 UTSW 9 19537546 missense probably benign 0.03
R1661:Olfr853 UTSW 9 19537328 missense probably benign 0.00
R1696:Olfr853 UTSW 9 19537894 missense probably damaging 1.00
R2004:Olfr853 UTSW 9 19537392 nonsense probably null
R2182:Olfr853 UTSW 9 19537342 missense probably benign 0.24
R3730:Olfr853 UTSW 9 19537151 missense probably benign 0.01
R4002:Olfr853 UTSW 9 19537906 missense probably benign 0.00
R4627:Olfr853 UTSW 9 19537673 missense possibly damaging 0.86
R5027:Olfr853 UTSW 9 19537277 missense probably damaging 1.00
R5931:Olfr853 UTSW 9 19537333 missense probably benign 0.38
R6229:Olfr853 UTSW 9 19537718 missense possibly damaging 0.91
R6564:Olfr853 UTSW 9 19537210 missense possibly damaging 0.95
R6718:Olfr853 UTSW 9 19537199 missense probably damaging 1.00
R7247:Olfr853 UTSW 9 19537333 missense probably benign 0.38
R7347:Olfr853 UTSW 9 19537099 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CTATAGATAAATGGGTTCAGCATAGGC -3'
(R):5'- GTGGATGCCCTTCTACATGG -3'

Sequencing Primer
(F):5'- GCTACAGAAGTTCTCCTGTATGAC -3'
(R):5'- CATGGCTTAATGACATTGCGTC -3'
Posted On2016-10-05