Incidental Mutation 'R5486:Taar7a'
List |< first << previous [record 38 of 44] next >> last >|
ID430371
Institutional Source Beutler Lab
Gene Symbol Taar7a
Ensembl Gene ENSMUSG00000095647
Gene Nametrace amine-associated receptor 7A
SynonymsTaar7a, LOC215856
MMRRC Submission 043047-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R5486 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location23992405-23993481 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 23992458 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 342 (T342S)
Ref Sequence ENSEMBL: ENSMUSP00000077616 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078532]
Predicted Effect probably benign
Transcript: ENSMUST00000078532
AA Change: T342S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000077616
Gene: ENSMUSG00000095647
AA Change: T342S

DomainStartEndE-ValueType
Pfam:7tm_4 54 344 9.2e-10 PFAM
Pfam:7TM_GPCR_Srx 56 261 5.2e-9 PFAM
Pfam:7tm_1 64 326 3.2e-58 PFAM
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.2%
  • 10x: 95.1%
  • 20x: 90.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930009A15Rik G T 10: 115,579,905 probably benign Het
Acad8 A T 9: 26,999,495 M1K probably null Het
Adam12 C A 7: 133,907,672 R786S possibly damaging Het
Add3 G A 19: 53,244,387 V604I probably benign Het
Alpk2 A T 18: 65,294,354 probably null Het
Ano3 T C 2: 110,745,870 D102G probably damaging Het
Bdp1 T C 13: 100,098,510 Y192C probably damaging Het
Bod1l A T 5: 41,807,181 D2693E possibly damaging Het
Ccdc7a T C 8: 128,985,403 N284D probably damaging Het
Clic6 A G 16: 92,529,852 probably null Het
Cln5 T C 14: 103,076,194 I294T probably damaging Het
Cmklr1 C G 5: 113,614,929 D4H possibly damaging Het
Cyp2d9 T A 15: 82,452,578 W43R probably damaging Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Erlec1 A T 11: 30,935,047 H413Q probably damaging Het
Fam168a T A 7: 100,834,169 M203K probably damaging Het
Fat2 A T 11: 55,253,681 S4122R probably benign Het
Fgd4 A T 16: 16,475,037 L272Q probably damaging Het
Hpcal4 A G 4: 123,190,764 K162R probably benign Het
Iars T A 13: 49,709,573 probably null Het
Lbr A G 1: 181,818,838 probably null Het
Lrp2 T C 2: 69,437,465 I4259V probably benign Het
Mcm3 C T 1: 20,814,894 G189S probably damaging Het
Nr1d2 A G 14: 18,206,860 V137A possibly damaging Het
Olfr646 C A 7: 104,106,498 T73N probably damaging Het
Olfr665 T A 7: 104,880,961 C85S probably benign Het
Olfr853 A G 9: 19,537,294 V212A probably benign Het
Pim3 T C 15: 88,863,222 V97A possibly damaging Het
Piwil2 T C 14: 70,401,431 N479S probably benign Het
Pld3 C A 7: 27,533,731 W365L probably damaging Het
Plk3 C A 4: 117,130,403 E412* probably null Het
Psmd1 A G 1: 86,137,050 I935V possibly damaging Het
Sh2b2 A G 5: 136,232,090 S91P probably benign Het
Skor2 A G 18: 76,858,700 N39S unknown Het
Slc22a22 A G 15: 57,263,451 V55A probably damaging Het
Smg7 A G 1: 152,846,176 S595P probably damaging Het
Snrnp200 C T 2: 127,233,066 P1520S possibly damaging Het
Tecpr2 A T 12: 110,933,015 I606F probably benign Het
Tex19.2 A T 11: 121,117,478 M48K probably benign Het
Thoc1 A G 18: 9,992,204 T511A probably benign Het
Trpc2 GTGTCCTA GTGTCCTATGTCCTA 7: 102,095,213 probably null Het
Ubr5 C A 15: 38,008,739 A1077S probably benign Het
Wdr95 A T 5: 149,596,330 R571* probably null Het
Other mutations in Taar7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00476:Taar7a APN 10 23992396 unclassified probably benign
IGL02408:Taar7a APN 10 23992602 missense probably benign
PIT4434001:Taar7a UTSW 10 23993421 missense probably benign
R0422:Taar7a UTSW 10 23993274 missense probably benign 0.02
R1029:Taar7a UTSW 10 23992541 missense possibly damaging 0.65
R1742:Taar7a UTSW 10 23993219 missense probably damaging 0.98
R2104:Taar7a UTSW 10 23993061 missense probably damaging 0.99
R2421:Taar7a UTSW 10 23992517 missense probably damaging 1.00
R3907:Taar7a UTSW 10 23992559 missense probably benign 0.25
R4021:Taar7a UTSW 10 23993386 missense probably benign 0.00
R5180:Taar7a UTSW 10 23993148 missense probably damaging 1.00
R5507:Taar7a UTSW 10 23992631 missense probably damaging 0.98
R5587:Taar7a UTSW 10 23992828 missense probably benign 0.00
R5766:Taar7a UTSW 10 23993362 missense probably benign 0.01
R5861:Taar7a UTSW 10 23992439 missense probably benign
R7201:Taar7a UTSW 10 23992460 missense probably benign 0.04
R7506:Taar7a UTSW 10 23992994 missense possibly damaging 0.50
X0064:Taar7a UTSW 10 23992617 missense probably damaging 1.00
Z1177:Taar7a UTSW 10 23992892 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCAGGCAGCATGAATAGCTG -3'
(R):5'- AAACCCTGGGCATTGCAGTG -3'

Sequencing Primer
(F):5'- GGATTTACATGCTTGGATCACAGCTC -3'
(R):5'- AGTGGCTGCCTTCCTCC -3'
Posted On2016-10-05