Incidental Mutation 'R5486:Erlec1'
ID430374
Institutional Source Beutler Lab
Gene Symbol Erlec1
Ensembl Gene ENSMUSG00000020311
Gene Nameendoplasmic reticulum lectin 1
Synonyms4933407N01Rik
MMRRC Submission 043047-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5486 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location30930774-30954335 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 30935047 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 413 (H413Q)
Ref Sequence ENSEMBL: ENSMUSP00000072929 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073192] [ENSMUST00000129593] [ENSMUST00000203878]
Predicted Effect probably damaging
Transcript: ENSMUST00000073192
AA Change: H413Q

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000072929
Gene: ENSMUSG00000020311
AA Change: H413Q

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Pfam:PRKCSH 111 199 6.6e-21 PFAM
Pfam:PRKCSH 342 421 2e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129593
SMART Domains Protein: ENSMUSP00000129078
Gene: ENSMUSG00000020311

DomainStartEndE-ValueType
SCOP:d1c39a_ 2 52 1e-3 SMART
Pfam:PRKCSH 149 225 1.2e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143126
SMART Domains Protein: ENSMUSP00000126490
Gene: ENSMUSG00000020311

DomainStartEndE-ValueType
Pfam:PRKCSH 52 80 2.3e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203878
SMART Domains Protein: ENSMUSP00000144900
Gene: ENSMUSG00000020305

DomainStartEndE-ValueType
low complexity region 20 36 N/A INTRINSIC
ANK 48 77 3.5e-2 SMART
ANK 81 110 8e-3 SMART
ANK 117 146 4.8e-5 SMART
ANK 150 179 1.7e-7 SMART
ANK 184 213 1.8e-4 SMART
ANK 217 246 1.8e-6 SMART
ANK 250 279 1.2e-7 SMART
ANK 285 315 1.1e0 SMART
ANK 318 347 1.2e-3 SMART
ANK 354 385 7.7e-1 SMART
SOCS 493 542 2.8e-4 SMART
SOCS_box 499 541 1.6e-17 SMART
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.2%
  • 10x: 95.1%
  • 20x: 90.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a resident endoplasmic reticulum (ER) protein that functions in N-glycan recognition. This protein is thought to be involved in ER-associated degradation via its interaction with the membrane-associated ubiquitin ligase complex. It also functions as a regulator of multiple cellular stress-response pathways in a manner that promotes metastatic cell survival. Alternative splicing results in multiple transcript variants. A related pseudogene has been identified on chromosome 21. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930009A15Rik G T 10: 115,579,905 probably benign Het
Acad8 A T 9: 26,999,495 M1K probably null Het
Adam12 C A 7: 133,907,672 R786S possibly damaging Het
Add3 G A 19: 53,244,387 V604I probably benign Het
Alpk2 A T 18: 65,294,354 probably null Het
Ano3 T C 2: 110,745,870 D102G probably damaging Het
Bdp1 T C 13: 100,098,510 Y192C probably damaging Het
Bod1l A T 5: 41,807,181 D2693E possibly damaging Het
Ccdc7a T C 8: 128,985,403 N284D probably damaging Het
Clic6 A G 16: 92,529,852 probably null Het
Cln5 T C 14: 103,076,194 I294T probably damaging Het
Cmklr1 C G 5: 113,614,929 D4H possibly damaging Het
Cyp2d9 T A 15: 82,452,578 W43R probably damaging Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Fam168a T A 7: 100,834,169 M203K probably damaging Het
Fat2 A T 11: 55,253,681 S4122R probably benign Het
Fgd4 A T 16: 16,475,037 L272Q probably damaging Het
Hpcal4 A G 4: 123,190,764 K162R probably benign Het
Iars T A 13: 49,709,573 probably null Het
Lbr A G 1: 181,818,838 probably null Het
Lrp2 T C 2: 69,437,465 I4259V probably benign Het
Mcm3 C T 1: 20,814,894 G189S probably damaging Het
Nr1d2 A G 14: 18,206,860 V137A possibly damaging Het
Olfr646 C A 7: 104,106,498 T73N probably damaging Het
Olfr665 T A 7: 104,880,961 C85S probably benign Het
Olfr853 A G 9: 19,537,294 V212A probably benign Het
Pim3 T C 15: 88,863,222 V97A possibly damaging Het
Piwil2 T C 14: 70,401,431 N479S probably benign Het
Pld3 C A 7: 27,533,731 W365L probably damaging Het
Plk3 C A 4: 117,130,403 E412* probably null Het
Psmd1 A G 1: 86,137,050 I935V possibly damaging Het
Sh2b2 A G 5: 136,232,090 S91P probably benign Het
Skor2 A G 18: 76,858,700 N39S unknown Het
Slc22a22 A G 15: 57,263,451 V55A probably damaging Het
Smg7 A G 1: 152,846,176 S595P probably damaging Het
Snrnp200 C T 2: 127,233,066 P1520S possibly damaging Het
Taar7a T A 10: 23,992,458 T342S probably benign Het
Tecpr2 A T 12: 110,933,015 I606F probably benign Het
Tex19.2 A T 11: 121,117,478 M48K probably benign Het
Thoc1 A G 18: 9,992,204 T511A probably benign Het
Trpc2 GTGTCCTA GTGTCCTATGTCCTA 7: 102,095,213 probably null Het
Ubr5 C A 15: 38,008,739 A1077S probably benign Het
Wdr95 A T 5: 149,596,330 R571* probably null Het
Other mutations in Erlec1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00326:Erlec1 APN 11 30948510 missense possibly damaging 0.84
IGL00537:Erlec1 APN 11 30939591 missense probably benign 0.04
IGL00766:Erlec1 APN 11 30950623 nonsense probably null
IGL01760:Erlec1 APN 11 30934731 missense probably benign 0.34
IGL02505:Erlec1 APN 11 30950767 missense probably damaging 1.00
IGL02633:Erlec1 APN 11 30948430 nonsense probably null
R0674:Erlec1 UTSW 11 30935073 intron probably benign
R1211:Erlec1 UTSW 11 30948298 critical splice donor site probably null
R1974:Erlec1 UTSW 11 30939604 missense possibly damaging 0.83
R4326:Erlec1 UTSW 11 30949972 missense probably benign
R4328:Erlec1 UTSW 11 30949972 missense probably benign
R4392:Erlec1 UTSW 11 30943697 critical splice donor site probably null
R4641:Erlec1 UTSW 11 30948442 nonsense probably null
R4697:Erlec1 UTSW 11 30952640 missense probably benign 0.27
R4917:Erlec1 UTSW 11 30934710 missense possibly damaging 0.56
R5735:Erlec1 UTSW 11 30950591 missense probably benign 0.00
R5775:Erlec1 UTSW 11 30943848 missense probably benign 0.11
R6475:Erlec1 UTSW 11 30948442 nonsense probably null
R7027:Erlec1 UTSW 11 30950790 missense probably damaging 1.00
R7235:Erlec1 UTSW 11 30950751 missense possibly damaging 0.91
R7440:Erlec1 UTSW 11 30950818 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- AAACCTTAAGTGGACCCAGC -3'
(R):5'- CAGAAATCCTAAGGGCTGCTATTAG -3'

Sequencing Primer
(F):5'- TTAAGTGGACCCAGCATAACTTAAC -3'
(R):5'- GTATTTGAGTTACTGTACCAAGCTC -3'
Posted On2016-10-05