Incidental Mutation 'R5486:Bdp1'
ID430379
Institutional Source Beutler Lab
Gene Symbol Bdp1
Ensembl Gene ENSMUSG00000049658
Gene NameB double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB
SynonymsTAF3B1, TFC5, Tfnr, B130055N23Rik, TFIIIB90, TFIIIB150, G630013P12Rik
MMRRC Submission 043047-MU
Accession Numbers

Genbank: NM_001081061; MGI: 1347077

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5486 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location100017994-100104070 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 100098510 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 192 (Y192C)
Ref Sequence ENSEMBL: ENSMUSP00000105005 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038104] [ENSMUST00000109379] [ENSMUST00000163097]
Predicted Effect probably damaging
Transcript: ENSMUST00000038104
AA Change: Y192C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000038321
Gene: ENSMUSG00000049658
AA Change: Y192C

DomainStartEndE-ValueType
low complexity region 25 45 N/A INTRINSIC
low complexity region 81 92 N/A INTRINSIC
low complexity region 147 164 N/A INTRINSIC
low complexity region 231 242 N/A INTRINSIC
SANT 301 349 1.52e-4 SMART
coiled coil region 375 399 N/A INTRINSIC
coiled coil region 457 487 N/A INTRINSIC
internal_repeat_1 593 895 3.56e-18 PROSPERO
coiled coil region 1013 1038 N/A INTRINSIC
internal_repeat_1 1253 1612 3.56e-18 PROSPERO
low complexity region 1718 1733 N/A INTRINSIC
low complexity region 1763 1774 N/A INTRINSIC
low complexity region 1912 1921 N/A INTRINSIC
low complexity region 2185 2199 N/A INTRINSIC
low complexity region 2335 2346 N/A INTRINSIC
low complexity region 2398 2412 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109379
AA Change: Y192C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105005
Gene: ENSMUSG00000049658
AA Change: Y192C

DomainStartEndE-ValueType
low complexity region 25 45 N/A INTRINSIC
low complexity region 81 92 N/A INTRINSIC
low complexity region 147 164 N/A INTRINSIC
low complexity region 231 242 N/A INTRINSIC
SANT 301 349 1.52e-4 SMART
coiled coil region 457 487 N/A INTRINSIC
internal_repeat_1 593 895 4.79e-19 PROSPERO
coiled coil region 1013 1038 N/A INTRINSIC
internal_repeat_1 1253 1612 4.79e-19 PROSPERO
low complexity region 1718 1733 N/A INTRINSIC
low complexity region 1763 1774 N/A INTRINSIC
low complexity region 1912 1921 N/A INTRINSIC
low complexity region 2185 2199 N/A INTRINSIC
low complexity region 2335 2346 N/A INTRINSIC
low complexity region 2398 2412 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163097
SMART Domains Protein: ENSMUSP00000126435
Gene: ENSMUSG00000049658

DomainStartEndE-ValueType
low complexity region 25 45 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167203
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.2%
  • 10x: 95.1%
  • 20x: 90.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a subunit of the TFIIIB transcription initiation complex, which recruits RNA polymerase III to target promoters in order to initiate transcription. The encoded protein localizes to concentrated aggregates in the nucleus, and is required for transcription from all three types of polymerase III promoters. It is phosphorylated by casein kinase II during mitosis, resulting in its release from chromatin and suppression of polymerase III transcription. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(4) : Gene trapped(4)

Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930009A15Rik G T 10: 115,579,905 probably benign Het
Acad8 A T 9: 26,999,495 M1K probably null Het
Adam12 C A 7: 133,907,672 R786S possibly damaging Het
Add3 G A 19: 53,244,387 V604I probably benign Het
Alpk2 A T 18: 65,294,354 probably null Het
Ano3 T C 2: 110,745,870 D102G probably damaging Het
Bod1l A T 5: 41,807,181 D2693E possibly damaging Het
Ccdc7a T C 8: 128,985,403 N284D probably damaging Het
Clic6 A G 16: 92,529,852 probably null Het
Cln5 T C 14: 103,076,194 I294T probably damaging Het
Cmklr1 C G 5: 113,614,929 D4H possibly damaging Het
Cyp2d9 T A 15: 82,452,578 W43R probably damaging Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Erlec1 A T 11: 30,935,047 H413Q probably damaging Het
Fam168a T A 7: 100,834,169 M203K probably damaging Het
Fat2 A T 11: 55,253,681 S4122R probably benign Het
Fgd4 A T 16: 16,475,037 L272Q probably damaging Het
Hpcal4 A G 4: 123,190,764 K162R probably benign Het
Iars T A 13: 49,709,573 probably null Het
Lbr A G 1: 181,818,838 probably null Het
Lrp2 T C 2: 69,437,465 I4259V probably benign Het
Mcm3 C T 1: 20,814,894 G189S probably damaging Het
Nr1d2 A G 14: 18,206,860 V137A possibly damaging Het
Olfr646 C A 7: 104,106,498 T73N probably damaging Het
Olfr665 T A 7: 104,880,961 C85S probably benign Het
Olfr853 A G 9: 19,537,294 V212A probably benign Het
Pim3 T C 15: 88,863,222 V97A possibly damaging Het
Piwil2 T C 14: 70,401,431 N479S probably benign Het
Pld3 C A 7: 27,533,731 W365L probably damaging Het
Plk3 C A 4: 117,130,403 E412* probably null Het
Psmd1 A G 1: 86,137,050 I935V possibly damaging Het
Sh2b2 A G 5: 136,232,090 S91P probably benign Het
Skor2 A G 18: 76,858,700 N39S unknown Het
Slc22a22 A G 15: 57,263,451 V55A probably damaging Het
Smg7 A G 1: 152,846,176 S595P probably damaging Het
Snrnp200 C T 2: 127,233,066 P1520S possibly damaging Het
Taar7a T A 10: 23,992,458 T342S probably benign Het
Tecpr2 A T 12: 110,933,015 I606F probably benign Het
Tex19.2 A T 11: 121,117,478 M48K probably benign Het
Thoc1 A G 18: 9,992,204 T511A probably benign Het
Trpc2 GTGTCCTA GTGTCCTATGTCCTA 7: 102,095,213 probably null Het
Ubr5 C A 15: 38,008,739 A1077S probably benign Het
Wdr95 A T 5: 149,596,330 R571* probably null Het
Other mutations in Bdp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Bdp1 APN 13 100098510 missense probably damaging 1.00
IGL00096:Bdp1 APN 13 100060865 missense possibly damaging 0.61
IGL00160:Bdp1 APN 13 100061198 missense probably benign 0.00
IGL00924:Bdp1 APN 13 100097579 missense possibly damaging 0.89
IGL01337:Bdp1 APN 13 100056192 missense probably benign 0.00
IGL01344:Bdp1 APN 13 100078080 missense probably benign 0.06
IGL01347:Bdp1 APN 13 100070203 missense possibly damaging 0.79
IGL01620:Bdp1 APN 13 100084205 splice site probably benign
IGL01871:Bdp1 APN 13 100066053 missense probably benign 0.01
IGL02008:Bdp1 APN 13 100023827 missense possibly damaging 0.92
IGL02112:Bdp1 APN 13 100037800 missense probably benign 0.02
IGL02214:Bdp1 APN 13 100041535 missense probably benign 0.00
IGL02236:Bdp1 APN 13 100060891 missense probably benign
IGL02307:Bdp1 APN 13 100093438 missense probably damaging 1.00
IGL02364:Bdp1 APN 13 100055308 splice site probably benign
IGL02415:Bdp1 APN 13 100089408 missense probably damaging 0.96
IGL02601:Bdp1 APN 13 100098514 missense possibly damaging 0.72
IGL02605:Bdp1 APN 13 100078115 critical splice acceptor site probably null
IGL02664:Bdp1 APN 13 100051539 missense probably benign 0.29
IGL02738:Bdp1 APN 13 100051353 missense probably benign 0.26
IGL02754:Bdp1 APN 13 100060973 missense possibly damaging 0.94
IGL02967:Bdp1 APN 13 100042270 missense possibly damaging 0.92
IGL02974:Bdp1 APN 13 100055292 missense probably benign 0.00
IGL03156:Bdp1 APN 13 100061036 missense probably benign 0.44
IGL03166:Bdp1 APN 13 100035800 missense probably benign 0.28
IGL03232:Bdp1 APN 13 100051481 missense probably damaging 1.00
D3080:Bdp1 UTSW 13 100023621 missense probably benign 0.02
R0115:Bdp1 UTSW 13 100041454 missense probably benign 0.28
R0481:Bdp1 UTSW 13 100041454 missense probably benign 0.28
R0619:Bdp1 UTSW 13 100037858 missense probably benign 0.00
R0730:Bdp1 UTSW 13 100058951 splice site probably benign
R0744:Bdp1 UTSW 13 100035825 missense probably benign 0.01
R0833:Bdp1 UTSW 13 100035825 missense probably benign 0.01
R1307:Bdp1 UTSW 13 100049763 missense possibly damaging 0.89
R1325:Bdp1 UTSW 13 100099008 missense probably damaging 0.97
R1346:Bdp1 UTSW 13 100078755 nonsense probably null
R1644:Bdp1 UTSW 13 100060940 missense probably benign 0.03
R1670:Bdp1 UTSW 13 100027433 critical splice donor site probably null
R1836:Bdp1 UTSW 13 100035145 missense probably benign
R1869:Bdp1 UTSW 13 100042201 missense probably damaging 0.99
R1920:Bdp1 UTSW 13 100098589 missense probably benign 0.30
R1944:Bdp1 UTSW 13 100074381 splice site probably null
R2030:Bdp1 UTSW 13 100061189 missense probably benign 0.00
R2069:Bdp1 UTSW 13 100050988 missense probably benign 0.00
R2180:Bdp1 UTSW 13 100061405 small insertion probably benign
R2263:Bdp1 UTSW 13 100066037 missense probably damaging 0.96
R2277:Bdp1 UTSW 13 100061330 missense probably benign 0.05
R2277:Bdp1 UTSW 13 100061339 missense probably damaging 1.00
R2278:Bdp1 UTSW 13 100061330 missense probably benign 0.05
R2278:Bdp1 UTSW 13 100061339 missense probably damaging 1.00
R2336:Bdp1 UTSW 13 100053002 missense probably damaging 0.99
R2380:Bdp1 UTSW 13 100060370 missense probably benign 0.08
R3154:Bdp1 UTSW 13 100049814 missense probably damaging 1.00
R4212:Bdp1 UTSW 13 100059585 missense probably benign
R4322:Bdp1 UTSW 13 100092223 missense probably damaging 0.97
R4414:Bdp1 UTSW 13 100030861 missense probably damaging 0.99
R4415:Bdp1 UTSW 13 100030861 missense probably damaging 0.99
R4764:Bdp1 UTSW 13 100056267 missense probably damaging 0.99
R4766:Bdp1 UTSW 13 100049868 missense probably damaging 0.96
R4888:Bdp1 UTSW 13 100051119 missense probably benign 0.26
R4914:Bdp1 UTSW 13 100056336 missense probably benign 0.28
R4917:Bdp1 UTSW 13 100055205 missense probably damaging 0.99
R4918:Bdp1 UTSW 13 100055205 missense probably damaging 0.99
R5170:Bdp1 UTSW 13 100030794 nonsense probably null
R5266:Bdp1 UTSW 13 100067535 missense probably benign 0.33
R5312:Bdp1 UTSW 13 100097601 splice site probably null
R5420:Bdp1 UTSW 13 100066043 missense possibly damaging 0.88
R5909:Bdp1 UTSW 13 100092286 missense probably benign 0.08
R5913:Bdp1 UTSW 13 100051104 missense probably benign 0.41
R6018:Bdp1 UTSW 13 100038224 missense probably benign 0.00
R6037:Bdp1 UTSW 13 100027449 missense possibly damaging 0.65
R6037:Bdp1 UTSW 13 100027449 missense possibly damaging 0.65
R6700:Bdp1 UTSW 13 100025528 missense probably benign 0.00
R6969:Bdp1 UTSW 13 100074531 missense probably damaging 0.97
R6972:Bdp1 UTSW 13 100037761 missense probably null 1.00
R6996:Bdp1 UTSW 13 100043813 missense probably damaging 1.00
R7043:Bdp1 UTSW 13 100078707 missense probably benign 0.03
R7060:Bdp1 UTSW 13 100059494 missense probably damaging 1.00
R7105:Bdp1 UTSW 13 100070181 missense probably damaging 1.00
R7155:Bdp1 UTSW 13 100061151 missense possibly damaging 0.93
R7175:Bdp1 UTSW 13 100049970 missense probably damaging 0.97
R7177:Bdp1 UTSW 13 100049970 missense probably damaging 0.97
R7327:Bdp1 UTSW 13 100041532 missense probably damaging 0.97
R7512:Bdp1 UTSW 13 100050949 missense probably benign 0.03
R7562:Bdp1 UTSW 13 100025541 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TCATCCTAGAGAGCAGTTACTTGC -3'
(R):5'- ACCCAGCCTTCCTATAGTCCAG -3'

Sequencing Primer
(F):5'- GCAGTTACTTGCATAGGCTTAGACC -3'
(R):5'- ATAGTCCAGCCTTCTGATAGTTC -3'
Posted On2016-10-05