Incidental Mutation 'R5486:Cln5'
ID430382
Institutional Source Beutler Lab
Gene Symbol Cln5
Ensembl Gene ENSMUSG00000022125
Gene Nameceroid-lipofuscinosis, neuronal 5
SynonymsA730075N08Rik
MMRRC Submission 043047-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.224) question?
Stock #R5486 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location103070216-103077628 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 103076194 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 294 (I294T)
Ref Sequence ENSEMBL: ENSMUSP00000022721 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022720] [ENSMUST00000022721] [ENSMUST00000145693]
Predicted Effect probably benign
Transcript: ENSMUST00000022720
SMART Domains Protein: ENSMUSP00000022720
Gene: ENSMUSG00000022124

DomainStartEndE-ValueType
FBOX 39 79 5.92e-7 SMART
low complexity region 235 247 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000022721
AA Change: I294T

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000022721
Gene: ENSMUSG00000022125
AA Change: I294T

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Pfam:CLN5 34 332 9e-169 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145693
SMART Domains Protein: ENSMUSP00000116044
Gene: ENSMUSG00000022124

DomainStartEndE-ValueType
FBOX 39 79 5.92e-7 SMART
low complexity region 235 247 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000227117
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.2%
  • 10x: 95.1%
  • 20x: 90.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of eight which have been associated with neuronal ceroid lipofuscinoses (NCL). Also referred to as Batten disease, NCL comprises a class of autosomal recessive, neurodegenerative disorders affecting children. The genes responsible likely encode proteins involved in the degradation of post-translationally modified proteins in lysosomes. The primary defect in NCL disorders is thought to be associated with lysosomal storage function.[provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygous mutants showed loss of vision and accumulation of autofluorescent storage material in the central nervous system. Loss of a subset of GABAergic interneurons was seen in several brain areas. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930009A15Rik G T 10: 115,579,905 probably benign Het
Acad8 A T 9: 26,999,495 M1K probably null Het
Adam12 C A 7: 133,907,672 R786S possibly damaging Het
Add3 G A 19: 53,244,387 V604I probably benign Het
Alpk2 A T 18: 65,294,354 probably null Het
Ano3 T C 2: 110,745,870 D102G probably damaging Het
Bdp1 T C 13: 100,098,510 Y192C probably damaging Het
Bod1l A T 5: 41,807,181 D2693E possibly damaging Het
Ccdc7a T C 8: 128,985,403 N284D probably damaging Het
Clic6 A G 16: 92,529,852 probably null Het
Cmklr1 C G 5: 113,614,929 D4H possibly damaging Het
Cyp2d9 T A 15: 82,452,578 W43R probably damaging Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Erlec1 A T 11: 30,935,047 H413Q probably damaging Het
Fam168a T A 7: 100,834,169 M203K probably damaging Het
Fat2 A T 11: 55,253,681 S4122R probably benign Het
Fgd4 A T 16: 16,475,037 L272Q probably damaging Het
Hpcal4 A G 4: 123,190,764 K162R probably benign Het
Iars T A 13: 49,709,573 probably null Het
Lbr A G 1: 181,818,838 probably null Het
Lrp2 T C 2: 69,437,465 I4259V probably benign Het
Mcm3 C T 1: 20,814,894 G189S probably damaging Het
Nr1d2 A G 14: 18,206,860 V137A possibly damaging Het
Olfr646 C A 7: 104,106,498 T73N probably damaging Het
Olfr665 T A 7: 104,880,961 C85S probably benign Het
Olfr853 A G 9: 19,537,294 V212A probably benign Het
Pim3 T C 15: 88,863,222 V97A possibly damaging Het
Piwil2 T C 14: 70,401,431 N479S probably benign Het
Pld3 C A 7: 27,533,731 W365L probably damaging Het
Plk3 C A 4: 117,130,403 E412* probably null Het
Psmd1 A G 1: 86,137,050 I935V possibly damaging Het
Sh2b2 A G 5: 136,232,090 S91P probably benign Het
Skor2 A G 18: 76,858,700 N39S unknown Het
Slc22a22 A G 15: 57,263,451 V55A probably damaging Het
Smg7 A G 1: 152,846,176 S595P probably damaging Het
Snrnp200 C T 2: 127,233,066 P1520S possibly damaging Het
Taar7a T A 10: 23,992,458 T342S probably benign Het
Tecpr2 A T 12: 110,933,015 I606F probably benign Het
Tex19.2 A T 11: 121,117,478 M48K probably benign Het
Thoc1 A G 18: 9,992,204 T511A probably benign Het
Trpc2 GTGTCCTA GTGTCCTATGTCCTA 7: 102,095,213 probably null Het
Ubr5 C A 15: 38,008,739 A1077S probably benign Het
Wdr95 A T 5: 149,596,330 R571* probably null Het
Other mutations in Cln5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00719:Cln5 APN 14 103076032 missense possibly damaging 0.64
IGL02218:Cln5 APN 14 103075840 unclassified probably null
PIT4480001:Cln5 UTSW 14 103071778 nonsense probably null
R0649:Cln5 UTSW 14 103071761 missense probably benign
R2043:Cln5 UTSW 14 103075944 missense probably damaging 1.00
R2313:Cln5 UTSW 14 103071746 nonsense probably null
R3829:Cln5 UTSW 14 103073359 missense probably damaging 0.97
R6265:Cln5 UTSW 14 103073227 missense probably damaging 1.00
R6361:Cln5 UTSW 14 103076201 missense probably benign 0.05
R7361:Cln5 UTSW 14 103075903 missense probably damaging 1.00
R7869:Cln5 UTSW 14 103076065 missense probably damaging 1.00
R7952:Cln5 UTSW 14 103076065 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCTGAATTTGGAACAGAATTCAAG -3'
(R):5'- TGTAGACACAGCCCTGGAAG -3'

Sequencing Primer
(F):5'- GAGCCTATTTACCTGGGA -3'
(R):5'- AGAACATGGATGCTGCTGTC -3'
Posted On2016-10-05