Incidental Mutation 'R5486:Slc22a22'
List |< first << previous [record 35 of 44] next >> last >|
ID430384
Institutional Source Beutler Lab
Gene Symbol Slc22a22
Ensembl Gene ENSMUSG00000022366
Gene Namesolute carrier family 22 (organic cation transporter), member 22
SynonymsBC026439, OAT-PG
MMRRC Submission 043047-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R5486 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location57243767-57477625 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 57263451 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 55 (V55A)
Ref Sequence ENSEMBL: ENSMUSP00000123667 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022995] [ENSMUST00000110196] [ENSMUST00000137764]
Predicted Effect probably benign
Transcript: ENSMUST00000022995
AA Change: V74A

PolyPhen 2 Score 0.089 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000022995
Gene: ENSMUSG00000022366
AA Change: V74A

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:MFS_1 117 483 1.2e-26 PFAM
Pfam:Sugar_tr 144 447 1.3e-20 PFAM
Pfam:Sugar_tr 393 553 3.2e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110196
AA Change: V74A

PolyPhen 2 Score 0.089 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000105825
Gene: ENSMUSG00000022366
AA Change: V74A

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:MFS_1 116 483 1.4e-26 PFAM
Pfam:Sugar_tr 145 426 1e-19 PFAM
Pfam:Sugar_tr 391 553 2.7e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000137764
AA Change: V55A

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000123667
Gene: ENSMUSG00000022366
AA Change: V55A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.2%
  • 10x: 95.1%
  • 20x: 90.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930009A15Rik G T 10: 115,579,905 probably benign Het
Acad8 A T 9: 26,999,495 M1K probably null Het
Adam12 C A 7: 133,907,672 R786S possibly damaging Het
Add3 G A 19: 53,244,387 V604I probably benign Het
Alpk2 A T 18: 65,294,354 probably null Het
Ano3 T C 2: 110,745,870 D102G probably damaging Het
Bdp1 T C 13: 100,098,510 Y192C probably damaging Het
Bod1l A T 5: 41,807,181 D2693E possibly damaging Het
Ccdc7a T C 8: 128,985,403 N284D probably damaging Het
Clic6 A G 16: 92,529,852 probably null Het
Cln5 T C 14: 103,076,194 I294T probably damaging Het
Cmklr1 C G 5: 113,614,929 D4H possibly damaging Het
Cyp2d9 T A 15: 82,452,578 W43R probably damaging Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Erlec1 A T 11: 30,935,047 H413Q probably damaging Het
Fam168a T A 7: 100,834,169 M203K probably damaging Het
Fat2 A T 11: 55,253,681 S4122R probably benign Het
Fgd4 A T 16: 16,475,037 L272Q probably damaging Het
Hpcal4 A G 4: 123,190,764 K162R probably benign Het
Iars T A 13: 49,709,573 probably null Het
Lbr A G 1: 181,818,838 probably null Het
Lrp2 T C 2: 69,437,465 I4259V probably benign Het
Mcm3 C T 1: 20,814,894 G189S probably damaging Het
Nr1d2 A G 14: 18,206,860 V137A possibly damaging Het
Olfr646 C A 7: 104,106,498 T73N probably damaging Het
Olfr665 T A 7: 104,880,961 C85S probably benign Het
Olfr853 A G 9: 19,537,294 V212A probably benign Het
Pim3 T C 15: 88,863,222 V97A possibly damaging Het
Piwil2 T C 14: 70,401,431 N479S probably benign Het
Pld3 C A 7: 27,533,731 W365L probably damaging Het
Plk3 C A 4: 117,130,403 E412* probably null Het
Psmd1 A G 1: 86,137,050 I935V possibly damaging Het
Sh2b2 A G 5: 136,232,090 S91P probably benign Het
Skor2 A G 18: 76,858,700 N39S unknown Het
Smg7 A G 1: 152,846,176 S595P probably damaging Het
Snrnp200 C T 2: 127,233,066 P1520S possibly damaging Het
Taar7a T A 10: 23,992,458 T342S probably benign Het
Tecpr2 A T 12: 110,933,015 I606F probably benign Het
Tex19.2 A T 11: 121,117,478 M48K probably benign Het
Thoc1 A G 18: 9,992,204 T511A probably benign Het
Trpc2 GTGTCCTA GTGTCCTATGTCCTA 7: 102,095,213 probably null Het
Ubr5 C A 15: 38,008,739 A1077S probably benign Het
Wdr95 A T 5: 149,596,330 R571* probably null Het
Other mutations in Slc22a22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01137:Slc22a22 APN 15 57254278 missense probably damaging 1.00
IGL01140:Slc22a22 APN 15 57263338 missense probably damaging 1.00
IGL02350:Slc22a22 APN 15 57247448 missense probably benign 0.16
IGL02357:Slc22a22 APN 15 57247448 missense probably benign 0.16
IGL03115:Slc22a22 APN 15 57263274 missense probably damaging 1.00
IGL03244:Slc22a22 APN 15 57249552 splice site probably benign
IGL03384:Slc22a22 APN 15 57254216 missense probably benign 0.01
R0371:Slc22a22 UTSW 15 57249735 missense possibly damaging 0.82
R0501:Slc22a22 UTSW 15 57249650 missense probably benign 0.16
R0684:Slc22a22 UTSW 15 57263362 missense probably benign 0.04
R0722:Slc22a22 UTSW 15 57256553 unclassified probably null
R1240:Slc22a22 UTSW 15 57250872 missense probably benign 0.02
R1472:Slc22a22 UTSW 15 57247520 missense probably benign 0.03
R2040:Slc22a22 UTSW 15 57247540 nonsense probably null
R2125:Slc22a22 UTSW 15 57254240 missense probably damaging 1.00
R3707:Slc22a22 UTSW 15 57250973 missense probably damaging 1.00
R3921:Slc22a22 UTSW 15 57256544 missense probably benign 0.07
R4184:Slc22a22 UTSW 15 57256566 nonsense probably null
R4561:Slc22a22 UTSW 15 57263385 missense probably damaging 1.00
R4626:Slc22a22 UTSW 15 57263338 missense probably damaging 1.00
R4887:Slc22a22 UTSW 15 57249752 missense probably benign 0.20
R5181:Slc22a22 UTSW 15 57255123 missense probably benign 0.08
R5621:Slc22a22 UTSW 15 57259151 missense probably benign 0.02
R5812:Slc22a22 UTSW 15 57256473 critical splice donor site probably null
R5958:Slc22a22 UTSW 15 57263536 missense possibly damaging 0.95
R6517:Slc22a22 UTSW 15 57250969 missense probably benign 0.28
R6555:Slc22a22 UTSW 15 57259131 missense probably benign 0.08
R6724:Slc22a22 UTSW 15 57247532 missense probably damaging 1.00
R6744:Slc22a22 UTSW 15 57254272 missense possibly damaging 0.46
R7078:Slc22a22 UTSW 15 57263480 missense probably benign 0.01
R7085:Slc22a22 UTSW 15 57249649 missense probably benign 0.00
R7263:Slc22a22 UTSW 15 57249711 missense probably benign
R7335:Slc22a22 UTSW 15 57263375 missense probably benign 0.19
R7859:Slc22a22 UTSW 15 57250952 missense probably benign 0.02
R7871:Slc22a22 UTSW 15 57263355 missense possibly damaging 0.86
R8297:Slc22a22 UTSW 15 57259110 missense probably damaging 1.00
R8340:Slc22a22 UTSW 15 57263690 critical splice acceptor site probably null
R8358:Slc22a22 UTSW 15 57244847 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCTCAGTGACAATGGTAGAAG -3'
(R):5'- GCATTTGCAAGAATAGCCATGG -3'

Sequencing Primer
(F):5'- GTAAAAACACTGTGGTCATATGTCC -3'
(R):5'- CTACATCATGTAGGTGACAGTGG -3'
Posted On2016-10-05