Incidental Mutation 'R5486:Cyp2d9'
List |< first << previous [record 13 of 44] next >> last >|
ID430385
Institutional Source Beutler Lab
Gene Symbol Cyp2d9
Ensembl Gene ENSMUSG00000068086
Gene Namecytochrome P450, family 2, subfamily d, polypeptide 9
SynonymsCyp2d, testosterone 16alpha-hydroxylase, P450-2D
MMRRC Submission 043047-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R5486 (G1)
Quality Score204
Status Not validated
Chromosome15
Chromosomal Location82433437-82456845 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 82452578 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 43 (W43R)
Ref Sequence ENSEMBL: ENSMUSP00000155611 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089129] [ENSMUST00000229313] [ENSMUST00000229473] [ENSMUST00000229793] [ENSMUST00000230000] [ENSMUST00000230024] [ENSMUST00000230191] [ENSMUST00000231136]
Predicted Effect possibly damaging
Transcript: ENSMUST00000089129
AA Change: W43R

PolyPhen 2 Score 0.502 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000086530
Gene: ENSMUSG00000068086
AA Change: W43R

DomainStartEndE-ValueType
Pfam:p450 37 497 1.7e-142 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183779
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229181
Predicted Effect possibly damaging
Transcript: ENSMUST00000229313
AA Change: W43R

PolyPhen 2 Score 0.633 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect unknown
Transcript: ENSMUST00000229473
AA Change: W4R
Predicted Effect probably benign
Transcript: ENSMUST00000229793
Predicted Effect probably benign
Transcript: ENSMUST00000230000
Predicted Effect probably benign
Transcript: ENSMUST00000230024
Predicted Effect possibly damaging
Transcript: ENSMUST00000230191
AA Change: W43R

PolyPhen 2 Score 0.840 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231044
Predicted Effect probably damaging
Transcript: ENSMUST00000231136
AA Change: W43R

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.2%
  • 10x: 95.1%
  • 20x: 90.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930009A15Rik G T 10: 115,579,905 probably benign Het
Acad8 A T 9: 26,999,495 M1K probably null Het
Adam12 C A 7: 133,907,672 R786S possibly damaging Het
Add3 G A 19: 53,244,387 V604I probably benign Het
Alpk2 A T 18: 65,294,354 probably null Het
Ano3 T C 2: 110,745,870 D102G probably damaging Het
Bdp1 T C 13: 100,098,510 Y192C probably damaging Het
Bod1l A T 5: 41,807,181 D2693E possibly damaging Het
Ccdc7a T C 8: 128,985,403 N284D probably damaging Het
Clic6 A G 16: 92,529,852 probably null Het
Cln5 T C 14: 103,076,194 I294T probably damaging Het
Cmklr1 C G 5: 113,614,929 D4H possibly damaging Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Erlec1 A T 11: 30,935,047 H413Q probably damaging Het
Fam168a T A 7: 100,834,169 M203K probably damaging Het
Fat2 A T 11: 55,253,681 S4122R probably benign Het
Fgd4 A T 16: 16,475,037 L272Q probably damaging Het
Hpcal4 A G 4: 123,190,764 K162R probably benign Het
Iars T A 13: 49,709,573 probably null Het
Lbr A G 1: 181,818,838 probably null Het
Lrp2 T C 2: 69,437,465 I4259V probably benign Het
Mcm3 C T 1: 20,814,894 G189S probably damaging Het
Nr1d2 A G 14: 18,206,860 V137A possibly damaging Het
Olfr646 C A 7: 104,106,498 T73N probably damaging Het
Olfr665 T A 7: 104,880,961 C85S probably benign Het
Olfr853 A G 9: 19,537,294 V212A probably benign Het
Pim3 T C 15: 88,863,222 V97A possibly damaging Het
Piwil2 T C 14: 70,401,431 N479S probably benign Het
Pld3 C A 7: 27,533,731 W365L probably damaging Het
Plk3 C A 4: 117,130,403 E412* probably null Het
Psmd1 A G 1: 86,137,050 I935V possibly damaging Het
Sh2b2 A G 5: 136,232,090 S91P probably benign Het
Skor2 A G 18: 76,858,700 N39S unknown Het
Slc22a22 A G 15: 57,263,451 V55A probably damaging Het
Smg7 A G 1: 152,846,176 S595P probably damaging Het
Snrnp200 C T 2: 127,233,066 P1520S possibly damaging Het
Taar7a T A 10: 23,992,458 T342S probably benign Het
Tecpr2 A T 12: 110,933,015 I606F probably benign Het
Tex19.2 A T 11: 121,117,478 M48K probably benign Het
Thoc1 A G 18: 9,992,204 T511A probably benign Het
Trpc2 GTGTCCTA GTGTCCTATGTCCTA 7: 102,095,213 probably null Het
Ubr5 C A 15: 38,008,739 A1077S probably benign Het
Wdr95 A T 5: 149,596,330 R571* probably null Het
Other mutations in Cyp2d9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Cyp2d9 APN 15 82455094 missense probably benign 0.05
IGL00587:Cyp2d9 APN 15 82455143 missense possibly damaging 0.89
IGL00815:Cyp2d9 APN 15 82456375 missense possibly damaging 0.94
IGL03023:Cyp2d9 APN 15 82455518 missense probably damaging 0.99
IGL03410:Cyp2d9 APN 15 82456699 missense probably benign 0.00
R0417:Cyp2d9 UTSW 15 82455951 missense probably damaging 1.00
R0627:Cyp2d9 UTSW 15 82455790 missense probably damaging 1.00
R1326:Cyp2d9 UTSW 15 82455156 missense possibly damaging 0.50
R1501:Cyp2d9 UTSW 15 82454324 nonsense probably null
R1893:Cyp2d9 UTSW 15 82452606 missense probably damaging 0.97
R2496:Cyp2d9 UTSW 15 82452479 missense probably damaging 1.00
R2519:Cyp2d9 UTSW 15 82454518 intron probably null
R3155:Cyp2d9 UTSW 15 82452642 critical splice donor site probably null
R4691:Cyp2d9 UTSW 15 82455832 missense probably damaging 1.00
R4727:Cyp2d9 UTSW 15 82454401 start codon destroyed probably null 0.99
R4770:Cyp2d9 UTSW 15 82452573 missense probably damaging 0.98
R5319:Cyp2d9 UTSW 15 82454055 missense probably damaging 1.00
R5516:Cyp2d9 UTSW 15 82454327 missense probably null 1.00
R5646:Cyp2d9 UTSW 15 82452464 missense probably benign 0.01
R5898:Cyp2d9 UTSW 15 82455524 missense probably benign 0.02
R6193:Cyp2d9 UTSW 15 82452527 missense probably benign 0.01
R6288:Cyp2d9 UTSW 15 82456415 missense probably damaging 1.00
R6924:Cyp2d9 UTSW 15 82455212 missense probably damaging 1.00
R7524:Cyp2d9 UTSW 15 82455945 missense probably damaging 1.00
R7525:Cyp2d9 UTSW 15 82454092 missense possibly damaging 0.91
R7731:Cyp2d9 UTSW 15 82455432 critical splice acceptor site probably null
R7889:Cyp2d9 UTSW 15 82455826 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TTGGGGCTTCCTGATCCTAG -3'
(R):5'- GCTGCTACCAAAACATTTCTATGC -3'

Sequencing Primer
(F):5'- GCTTCCTGATCCTAGGTGTTG -3'
(R):5'- ACCAAAACATTTCTATGCCTGTC -3'
Posted On2016-10-05