Incidental Mutation 'R5486:Fgd4'
List |< first << previous [record 18 of 44] next >> last >|
ID430387
Institutional Source Beutler Lab
Gene Symbol Fgd4
Ensembl Gene ENSMUSG00000022788
Gene NameFYVE, RhoGEF and PH domain containing 4
SynonymsFrabin-alpha, 9330209B17Rik, ZFYVE6, Frabin-gamma, Frabin-beta, Frabin
MMRRC Submission 043047-MU
Accession Numbers

Genbank: NM_139232; MGI: 2183747

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5486 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location16416917-16600549 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 16475037 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 272 (L272Q)
Ref Sequence ENSEMBL: ENSMUSP00000125736 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069284] [ENSMUST00000159542] [ENSMUST00000161188] [ENSMUST00000161861] [ENSMUST00000162671]
Predicted Effect probably damaging
Transcript: ENSMUST00000069284
AA Change: L272Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000069573
Gene: ENSMUSG00000022788
AA Change: L272Q

DomainStartEndE-ValueType
RhoGEF 210 392 1.48e-57 SMART
PH 423 523 1.91e-19 SMART
FYVE 551 620 2.2e-30 SMART
PH 644 742 1.31e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159058
Predicted Effect probably damaging
Transcript: ENSMUST00000159542
AA Change: L272Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125649
Gene: ENSMUSG00000022788
AA Change: L272Q

DomainStartEndE-ValueType
RhoGEF 210 392 1.48e-57 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000161188
AA Change: L272Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123763
Gene: ENSMUSG00000022788
AA Change: L272Q

DomainStartEndE-ValueType
RhoGEF 210 392 1.48e-57 SMART
PH 423 523 1.91e-19 SMART
FYVE 551 603 1.94e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000161861
AA Change: L272Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125174
Gene: ENSMUSG00000022788
AA Change: L272Q

DomainStartEndE-ValueType
RhoGEF 210 392 1.48e-57 SMART
PH 423 523 1.91e-19 SMART
FYVE 551 620 2.2e-30 SMART
PH 644 742 1.31e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162045
SMART Domains Protein: ENSMUSP00000125435
Gene: ENSMUSG00000022788

DomainStartEndE-ValueType
RhoGEF 210 392 1.48e-57 SMART
PH 423 504 2.36e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162124
SMART Domains Protein: ENSMUSP00000125165
Gene: ENSMUSG00000022788

DomainStartEndE-ValueType
RhoGEF 166 348 1.48e-57 SMART
PH 379 460 2.36e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000162671
AA Change: L272Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125736
Gene: ENSMUSG00000022788
AA Change: L272Q

DomainStartEndE-ValueType
RhoGEF 210 392 1.48e-57 SMART
PH 423 523 1.91e-19 SMART
FYVE 551 620 2.2e-30 SMART
PH 644 742 1.31e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172181
SMART Domains Protein: ENSMUSP00000131870
Gene: ENSMUSG00000022788

DomainStartEndE-ValueType
RhoGEF 210 392 1.48e-57 SMART
PH 423 523 1.91e-19 SMART
FYVE 551 603 1.94e-8 SMART
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.2%
  • 10x: 95.1%
  • 20x: 90.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene is a member of the FYVE, RhoGEF and PH domain containing (FGD) family. The encoded protein is a Cdc42-specific guanine nucleotide exchange factor (GEF) that plays an essential role in regulating the actin cytoskeleton and cell morphology. Disruption of the gene in mouse causes abnormal nerve development and dysmyelination. Mutations in a similar gene in human can cause Charcot-Marie-Tooth disease type 4H (CMT4H), a disorder of the peripheral nervous system. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2014]
PHENOTYPE: Mice homozygous for a knock-out allele display dysmyelination in early peripheral nerve development, followed by severe myelin abnormalities, demyelinationn, nervous system electrophysiological deficits, and decreased grip strength at later stages. [provided by MGI curators]
Allele List at MGI

All alleles(60) : Gene trapped(60)

Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930009A15Rik G T 10: 115,579,905 probably benign Het
Acad8 A T 9: 26,999,495 M1K probably null Het
Adam12 C A 7: 133,907,672 R786S possibly damaging Het
Add3 G A 19: 53,244,387 V604I probably benign Het
Alpk2 A T 18: 65,294,354 probably null Het
Ano3 T C 2: 110,745,870 D102G probably damaging Het
Bdp1 T C 13: 100,098,510 Y192C probably damaging Het
Bod1l A T 5: 41,807,181 D2693E possibly damaging Het
Ccdc7a T C 8: 128,985,403 N284D probably damaging Het
Clic6 A G 16: 92,529,852 probably null Het
Cln5 T C 14: 103,076,194 I294T probably damaging Het
Cmklr1 C G 5: 113,614,929 D4H possibly damaging Het
Cyp2d9 T A 15: 82,452,578 W43R probably damaging Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Erlec1 A T 11: 30,935,047 H413Q probably damaging Het
Fam168a T A 7: 100,834,169 M203K probably damaging Het
Fat2 A T 11: 55,253,681 S4122R probably benign Het
Hpcal4 A G 4: 123,190,764 K162R probably benign Het
Iars T A 13: 49,709,573 probably null Het
Lbr A G 1: 181,818,838 probably null Het
Lrp2 T C 2: 69,437,465 I4259V probably benign Het
Mcm3 C T 1: 20,814,894 G189S probably damaging Het
Nr1d2 A G 14: 18,206,860 V137A possibly damaging Het
Olfr646 C A 7: 104,106,498 T73N probably damaging Het
Olfr665 T A 7: 104,880,961 C85S probably benign Het
Olfr853 A G 9: 19,537,294 V212A probably benign Het
Pim3 T C 15: 88,863,222 V97A possibly damaging Het
Piwil2 T C 14: 70,401,431 N479S probably benign Het
Pld3 C A 7: 27,533,731 W365L probably damaging Het
Plk3 C A 4: 117,130,403 E412* probably null Het
Psmd1 A G 1: 86,137,050 I935V possibly damaging Het
Sh2b2 A G 5: 136,232,090 S91P probably benign Het
Skor2 A G 18: 76,858,700 N39S unknown Het
Slc22a22 A G 15: 57,263,451 V55A probably damaging Het
Smg7 A G 1: 152,846,176 S595P probably damaging Het
Snrnp200 C T 2: 127,233,066 P1520S possibly damaging Het
Taar7a T A 10: 23,992,458 T342S probably benign Het
Tecpr2 A T 12: 110,933,015 I606F probably benign Het
Tex19.2 A T 11: 121,117,478 M48K probably benign Het
Thoc1 A G 18: 9,992,204 T511A probably benign Het
Trpc2 GTGTCCTA GTGTCCTATGTCCTA 7: 102,095,213 probably null Het
Ubr5 C A 15: 38,008,739 A1077S probably benign Het
Wdr95 A T 5: 149,596,330 R571* probably null Het
Other mutations in Fgd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01289:Fgd4 APN 16 16484303 missense probably damaging 0.99
IGL01455:Fgd4 APN 16 16490490 missense probably benign 0.22
IGL02035:Fgd4 APN 16 16490416 splice site probably benign
IGL02353:Fgd4 APN 16 16462045 missense probably damaging 0.96
IGL02360:Fgd4 APN 16 16462045 missense probably damaging 0.96
IGL03100:Fgd4 APN 16 16477519 splice site probably benign
11287:Fgd4 UTSW 16 16423923 missense probably damaging 1.00
R0787:Fgd4 UTSW 16 16423901 splice site probably benign
R0853:Fgd4 UTSW 16 16474387 splice site probably benign
R0879:Fgd4 UTSW 16 16477449 missense probably damaging 1.00
R1482:Fgd4 UTSW 16 16484473 missense probably benign 0.39
R1619:Fgd4 UTSW 16 16424056 missense possibly damaging 0.52
R1635:Fgd4 UTSW 16 16475029 nonsense probably null
R2018:Fgd4 UTSW 16 16435960 missense probably benign 0.15
R2120:Fgd4 UTSW 16 16425828 missense probably benign 0.44
R2292:Fgd4 UTSW 16 16436000 missense possibly damaging 0.95
R2902:Fgd4 UTSW 16 16425865 missense probably damaging 1.00
R4575:Fgd4 UTSW 16 16437032 missense probably damaging 1.00
R4747:Fgd4 UTSW 16 16423929 missense probably damaging 1.00
R4941:Fgd4 UTSW 16 16484538 missense probably benign
R5196:Fgd4 UTSW 16 16484142 missense probably benign 0.01
R5372:Fgd4 UTSW 16 16484291 missense probably benign 0.03
R5457:Fgd4 UTSW 16 16462009 missense probably benign 0.39
R6709:Fgd4 UTSW 16 16484481 missense probably benign 0.09
R6962:Fgd4 UTSW 16 16484087 splice site probably null
R7207:Fgd4 UTSW 16 16484556 missense probably benign 0.11
R7732:Fgd4 UTSW 16 16484595 missense probably benign
R7749:Fgd4 UTSW 16 16475154 missense probably benign 0.02
R7846:Fgd4 UTSW 16 16422726 missense probably damaging 1.00
R7937:Fgd4 UTSW 16 16469773 missense probably damaging 1.00
Z1088:Fgd4 UTSW 16 16484470 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CACAGAAGCAAATTTCATCTGGG -3'
(R):5'- GCCAGCATGGTGAAAACTGG -3'

Sequencing Primer
(F):5'- TTCATCTGGGGCAAAACATGAAC -3'
(R):5'- CATGGTGAAAACTGGTTAGCCCAC -3'
Posted On2016-10-05