Incidental Mutation 'R5486:Clic6'
List |< first << previous [record 10 of 44] next >> last >|
ID430388
Institutional Source Beutler Lab
Gene Symbol Clic6
Ensembl Gene ENSMUSG00000022949
Gene Namechloride intracellular channel 6
SynonymsCLIC1L, 5730466J16Rik
MMRRC Submission 043047-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.145) question?
Stock #R5486 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location92485736-92541243 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 92529852 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000023670 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023670] [ENSMUST00000162181]
Predicted Effect probably null
Transcript: ENSMUST00000023670
SMART Domains Protein: ENSMUSP00000023670
Gene: ENSMUSG00000022949

DomainStartEndE-ValueType
low complexity region 38 46 N/A INTRINSIC
low complexity region 62 74 N/A INTRINSIC
low complexity region 83 108 N/A INTRINSIC
low complexity region 151 169 N/A INTRINSIC
low complexity region 193 213 N/A INTRINSIC
low complexity region 225 245 N/A INTRINSIC
low complexity region 275 287 N/A INTRINSIC
low complexity region 308 318 N/A INTRINSIC
Pfam:GST_N_3 375 447 2e-9 PFAM
Pfam:GST_C_2 478 567 1.4e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162181
SMART Domains Protein: ENSMUSP00000124498
Gene: ENSMUSG00000022949

DomainStartEndE-ValueType
Pfam:GST_N_3 34 100 2.8e-10 PFAM
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.2%
  • 10x: 95.1%
  • 20x: 90.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the chloride intracellular channel family of proteins. The gene is part of a large triplicated region found on chromosomes 1, 6, and 21. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Nov 2015]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930009A15Rik G T 10: 115,579,905 probably benign Het
Acad8 A T 9: 26,999,495 M1K probably null Het
Adam12 C A 7: 133,907,672 R786S possibly damaging Het
Add3 G A 19: 53,244,387 V604I probably benign Het
Alpk2 A T 18: 65,294,354 probably null Het
Ano3 T C 2: 110,745,870 D102G probably damaging Het
Bdp1 T C 13: 100,098,510 Y192C probably damaging Het
Bod1l A T 5: 41,807,181 D2693E possibly damaging Het
Ccdc7a T C 8: 128,985,403 N284D probably damaging Het
Cln5 T C 14: 103,076,194 I294T probably damaging Het
Cmklr1 C G 5: 113,614,929 D4H possibly damaging Het
Cyp2d9 T A 15: 82,452,578 W43R probably damaging Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Erlec1 A T 11: 30,935,047 H413Q probably damaging Het
Fam168a T A 7: 100,834,169 M203K probably damaging Het
Fat2 A T 11: 55,253,681 S4122R probably benign Het
Fgd4 A T 16: 16,475,037 L272Q probably damaging Het
Hpcal4 A G 4: 123,190,764 K162R probably benign Het
Iars T A 13: 49,709,573 probably null Het
Lbr A G 1: 181,818,838 probably null Het
Lrp2 T C 2: 69,437,465 I4259V probably benign Het
Mcm3 C T 1: 20,814,894 G189S probably damaging Het
Nr1d2 A G 14: 18,206,860 V137A possibly damaging Het
Olfr646 C A 7: 104,106,498 T73N probably damaging Het
Olfr665 T A 7: 104,880,961 C85S probably benign Het
Olfr853 A G 9: 19,537,294 V212A probably benign Het
Pim3 T C 15: 88,863,222 V97A possibly damaging Het
Piwil2 T C 14: 70,401,431 N479S probably benign Het
Pld3 C A 7: 27,533,731 W365L probably damaging Het
Plk3 C A 4: 117,130,403 E412* probably null Het
Psmd1 A G 1: 86,137,050 I935V possibly damaging Het
Sh2b2 A G 5: 136,232,090 S91P probably benign Het
Skor2 A G 18: 76,858,700 N39S unknown Het
Slc22a22 A G 15: 57,263,451 V55A probably damaging Het
Smg7 A G 1: 152,846,176 S595P probably damaging Het
Snrnp200 C T 2: 127,233,066 P1520S possibly damaging Het
Taar7a T A 10: 23,992,458 T342S probably benign Het
Tecpr2 A T 12: 110,933,015 I606F probably benign Het
Tex19.2 A T 11: 121,117,478 M48K probably benign Het
Thoc1 A G 18: 9,992,204 T511A probably benign Het
Trpc2 GTGTCCTA GTGTCCTATGTCCTA 7: 102,095,213 probably null Het
Ubr5 C A 15: 38,008,739 A1077S probably benign Het
Wdr95 A T 5: 149,596,330 R571* probably null Het
Other mutations in Clic6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Clic6 APN 16 92499308 missense probably damaging 0.99
IGL02104:Clic6 APN 16 92498479 missense possibly damaging 0.72
IGL02387:Clic6 APN 16 92529919 missense probably damaging 1.00
IGL02437:Clic6 APN 16 92530929 missense probably damaging 1.00
IGL02617:Clic6 APN 16 92499318 missense probably benign 0.00
unsweetened UTSW 16 92530809 missense possibly damaging 0.79
R1544:Clic6 UTSW 16 92492073 intron probably benign
R1677:Clic6 UTSW 16 92528084 missense probably damaging 1.00
R2149:Clic6 UTSW 16 92499207 missense probably benign 0.00
R3965:Clic6 UTSW 16 92498844 missense probably benign 0.00
R4171:Clic6 UTSW 16 92497061 intron probably benign
R4545:Clic6 UTSW 16 92492157 intron probably benign
R4637:Clic6 UTSW 16 92497061 intron probably benign
R4649:Clic6 UTSW 16 92530939 critical splice donor site probably null
R5159:Clic6 UTSW 16 92528066 missense probably benign 0.13
R5249:Clic6 UTSW 16 92539451 missense probably damaging 1.00
R5582:Clic6 UTSW 16 92499454 missense possibly damaging 0.93
R6140:Clic6 UTSW 16 92539492 missense probably damaging 1.00
R6234:Clic6 UTSW 16 92499222 missense probably benign
R6379:Clic6 UTSW 16 92539535 missense probably damaging 1.00
R6593:Clic6 UTSW 16 92528117 missense possibly damaging 0.82
R7890:Clic6 UTSW 16 92499387 missense probably benign 0.41
RF012:Clic6 UTSW 16 92530809 missense possibly damaging 0.79
X0058:Clic6 UTSW 16 92498707 missense probably benign
Z1176:Clic6 UTSW 16 92498895 missense probably benign 0.26
Z1177:Clic6 UTSW 16 92499139 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- CTGATCTCACCAGGACCAGATC -3'
(R):5'- CTCTATGAAATGAGCCCAGATGC -3'

Sequencing Primer
(F):5'- GACCAGATCCAATGCAGTTCTC -3'
(R):5'- AGCCCAGATGCTCAGTCTC -3'
Posted On2016-10-05