Incidental Mutation 'R5486:Thoc1'
ID430389
Institutional Source Beutler Lab
Gene Symbol Thoc1
Ensembl Gene ENSMUSG00000024287
Gene NameTHO complex 1
Synonyms3110002N20Rik, NMP-84
MMRRC Submission 043047-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5486 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location9958180-9995484 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 9992204 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 511 (T511A)
Ref Sequence ENSEMBL: ENSMUSP00000025137 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025137] [ENSMUST00000092096] [ENSMUST00000116669]
Predicted Effect probably benign
Transcript: ENSMUST00000025137
AA Change: T511A

PolyPhen 2 Score 0.392 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000025137
Gene: ENSMUSG00000024287
AA Change: T511A

DomainStartEndE-ValueType
Pfam:efThoc1 69 546 7.2e-149 PFAM
DEATH 560 653 1.27e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000092096
SMART Domains Protein: ENSMUSP00000089728
Gene: ENSMUSG00000047879

DomainStartEndE-ValueType
UBQ 4 74 3.61e-11 SMART
Pfam:UCH 104 479 9e-57 PFAM
Pfam:UCH_1 105 456 3.2e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000116669
SMART Domains Protein: ENSMUSP00000112368
Gene: ENSMUSG00000047879

DomainStartEndE-ValueType
UBQ 4 73 2.63e-4 SMART
low complexity region 217 235 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133594
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.2%
  • 10x: 95.1%
  • 20x: 90.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] HPR1 is part of the TREX (transcription/export) complex, which includes TEX1 (MIM 606929), THO2 (MIM 300395), ALY (MIM 604171), and UAP56 (MIM 142560).[supplied by OMIM, Nov 2010]
PHENOTYPE: Mutations in this gene result in embryonic lethality around implantation in homozygotes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930009A15Rik G T 10: 115,579,905 probably benign Het
Acad8 A T 9: 26,999,495 M1K probably null Het
Adam12 C A 7: 133,907,672 R786S possibly damaging Het
Add3 G A 19: 53,244,387 V604I probably benign Het
Alpk2 A T 18: 65,294,354 probably null Het
Ano3 T C 2: 110,745,870 D102G probably damaging Het
Bdp1 T C 13: 100,098,510 Y192C probably damaging Het
Bod1l A T 5: 41,807,181 D2693E possibly damaging Het
Ccdc7a T C 8: 128,985,403 N284D probably damaging Het
Clic6 A G 16: 92,529,852 probably null Het
Cln5 T C 14: 103,076,194 I294T probably damaging Het
Cmklr1 C G 5: 113,614,929 D4H possibly damaging Het
Cyp2d9 T A 15: 82,452,578 W43R probably damaging Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Erlec1 A T 11: 30,935,047 H413Q probably damaging Het
Fam168a T A 7: 100,834,169 M203K probably damaging Het
Fat2 A T 11: 55,253,681 S4122R probably benign Het
Fgd4 A T 16: 16,475,037 L272Q probably damaging Het
Hpcal4 A G 4: 123,190,764 K162R probably benign Het
Iars T A 13: 49,709,573 probably null Het
Lbr A G 1: 181,818,838 probably null Het
Lrp2 T C 2: 69,437,465 I4259V probably benign Het
Mcm3 C T 1: 20,814,894 G189S probably damaging Het
Nr1d2 A G 14: 18,206,860 V137A possibly damaging Het
Olfr646 C A 7: 104,106,498 T73N probably damaging Het
Olfr665 T A 7: 104,880,961 C85S probably benign Het
Olfr853 A G 9: 19,537,294 V212A probably benign Het
Pim3 T C 15: 88,863,222 V97A possibly damaging Het
Piwil2 T C 14: 70,401,431 N479S probably benign Het
Pld3 C A 7: 27,533,731 W365L probably damaging Het
Plk3 C A 4: 117,130,403 E412* probably null Het
Psmd1 A G 1: 86,137,050 I935V possibly damaging Het
Sh2b2 A G 5: 136,232,090 S91P probably benign Het
Skor2 A G 18: 76,858,700 N39S unknown Het
Slc22a22 A G 15: 57,263,451 V55A probably damaging Het
Smg7 A G 1: 152,846,176 S595P probably damaging Het
Snrnp200 C T 2: 127,233,066 P1520S possibly damaging Het
Taar7a T A 10: 23,992,458 T342S probably benign Het
Tecpr2 A T 12: 110,933,015 I606F probably benign Het
Tex19.2 A T 11: 121,117,478 M48K probably benign Het
Trpc2 GTGTCCTA GTGTCCTATGTCCTA 7: 102,095,213 probably null Het
Ubr5 C A 15: 38,008,739 A1077S probably benign Het
Wdr95 A T 5: 149,596,330 R571* probably null Het
Other mutations in Thoc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00694:Thoc1 APN 18 9989744 missense possibly damaging 0.90
IGL01313:Thoc1 APN 18 9987158 missense probably benign 0.05
IGL01501:Thoc1 APN 18 9986321 missense possibly damaging 0.96
IGL01533:Thoc1 APN 18 9962376 missense probably benign 0.02
IGL01821:Thoc1 APN 18 9993429 missense probably benign
IGL01838:Thoc1 APN 18 9993386 missense possibly damaging 0.94
IGL02193:Thoc1 APN 18 9992863 missense probably benign 0.01
IGL02531:Thoc1 APN 18 9970258 missense probably benign
IGL03203:Thoc1 APN 18 9960483 splice site probably benign
R0724:Thoc1 UTSW 18 9963829 missense probably damaging 1.00
R0831:Thoc1 UTSW 18 9963267 missense probably benign 0.00
R2196:Thoc1 UTSW 18 9986300 missense probably damaging 0.99
R2256:Thoc1 UTSW 18 9993466 missense possibly damaging 0.85
R2257:Thoc1 UTSW 18 9993466 missense possibly damaging 0.85
R2289:Thoc1 UTSW 18 9984488 missense probably damaging 1.00
R2508:Thoc1 UTSW 18 9977947 missense probably damaging 0.99
R2937:Thoc1 UTSW 18 9959255 missense probably damaging 0.96
R3967:Thoc1 UTSW 18 9968787 missense probably damaging 0.99
R4012:Thoc1 UTSW 18 9987651 missense possibly damaging 0.87
R4320:Thoc1 UTSW 18 9960493 missense probably benign
R4686:Thoc1 UTSW 18 9970312 nonsense probably null
R4811:Thoc1 UTSW 18 9993438 missense probably damaging 0.97
R4962:Thoc1 UTSW 18 9962387 missense probably benign 0.01
R5648:Thoc1 UTSW 18 9962390 missense possibly damaging 0.94
R6291:Thoc1 UTSW 18 9993330 missense probably benign
R6406:Thoc1 UTSW 18 9977963 missense probably damaging 1.00
R6458:Thoc1 UTSW 18 9993333 missense probably benign
R7379:Thoc1 UTSW 18 9992902 missense probably benign 0.25
R7580:Thoc1 UTSW 18 9986343 missense probably damaging 0.98
R7685:Thoc1 UTSW 18 9993454 nonsense probably null
R7795:Thoc1 UTSW 18 9986300 missense probably damaging 0.96
R7799:Thoc1 UTSW 18 9984441 missense probably damaging 1.00
X0057:Thoc1 UTSW 18 9992178 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GGGACATAAGACCATTGACTTGC -3'
(R):5'- CCCCATTCTAAAACATGATGGTCTG -3'

Sequencing Primer
(F):5'- GAGCTGTTATTTGCAAGAGAGC -3'
(R):5'- AAACATGATGGTCTGCAGATTAC -3'
Posted On2016-10-05