Incidental Mutation 'R5486:Skor2'
ID430391
Institutional Source Beutler Lab
Gene Symbol Skor2
Ensembl Gene ENSMUSG00000091519
Gene NameSKI family transcriptional corepressor 2
SynonymsGm7348, Fussel18, Corl2
MMRRC Submission 043047-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5486 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location76856405-76900342 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 76858700 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 39 (N39S)
Ref Sequence ENSEMBL: ENSMUSP00000132338 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166956]
Predicted Effect unknown
Transcript: ENSMUST00000166956
AA Change: N39S
SMART Domains Protein: ENSMUSP00000132338
Gene: ENSMUSG00000091519
AA Change: N39S

DomainStartEndE-ValueType
Pfam:Ski_Sno 25 132 2.3e-41 PFAM
c-SKI_SMAD_bind 144 236 6.92e-55 SMART
low complexity region 261 305 N/A INTRINSIC
low complexity region 320 373 N/A INTRINSIC
low complexity region 426 452 N/A INTRINSIC
low complexity region 478 491 N/A INTRINSIC
low complexity region 513 551 N/A INTRINSIC
low complexity region 578 595 N/A INTRINSIC
low complexity region 645 680 N/A INTRINSIC
low complexity region 688 707 N/A INTRINSIC
low complexity region 722 741 N/A INTRINSIC
low complexity region 747 766 N/A INTRINSIC
low complexity region 817 838 N/A INTRINSIC
low complexity region 842 857 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.2%
  • 10x: 95.1%
  • 20x: 90.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for null mutations display neonatal and postnatal lethality, abnormal cerebellum development, and abnormal Purkinje cell differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930009A15Rik G T 10: 115,579,905 probably benign Het
Acad8 A T 9: 26,999,495 M1K probably null Het
Adam12 C A 7: 133,907,672 R786S possibly damaging Het
Add3 G A 19: 53,244,387 V604I probably benign Het
Alpk2 A T 18: 65,294,354 probably null Het
Ano3 T C 2: 110,745,870 D102G probably damaging Het
Bdp1 T C 13: 100,098,510 Y192C probably damaging Het
Bod1l A T 5: 41,807,181 D2693E possibly damaging Het
Ccdc7a T C 8: 128,985,403 N284D probably damaging Het
Clic6 A G 16: 92,529,852 probably null Het
Cln5 T C 14: 103,076,194 I294T probably damaging Het
Cmklr1 C G 5: 113,614,929 D4H possibly damaging Het
Cyp2d9 T A 15: 82,452,578 W43R probably damaging Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Erlec1 A T 11: 30,935,047 H413Q probably damaging Het
Fam168a T A 7: 100,834,169 M203K probably damaging Het
Fat2 A T 11: 55,253,681 S4122R probably benign Het
Fgd4 A T 16: 16,475,037 L272Q probably damaging Het
Hpcal4 A G 4: 123,190,764 K162R probably benign Het
Iars T A 13: 49,709,573 probably null Het
Lbr A G 1: 181,818,838 probably null Het
Lrp2 T C 2: 69,437,465 I4259V probably benign Het
Mcm3 C T 1: 20,814,894 G189S probably damaging Het
Nr1d2 A G 14: 18,206,860 V137A possibly damaging Het
Olfr646 C A 7: 104,106,498 T73N probably damaging Het
Olfr665 T A 7: 104,880,961 C85S probably benign Het
Olfr853 A G 9: 19,537,294 V212A probably benign Het
Pim3 T C 15: 88,863,222 V97A possibly damaging Het
Piwil2 T C 14: 70,401,431 N479S probably benign Het
Pld3 C A 7: 27,533,731 W365L probably damaging Het
Plk3 C A 4: 117,130,403 E412* probably null Het
Psmd1 A G 1: 86,137,050 I935V possibly damaging Het
Sh2b2 A G 5: 136,232,090 S91P probably benign Het
Slc22a22 A G 15: 57,263,451 V55A probably damaging Het
Smg7 A G 1: 152,846,176 S595P probably damaging Het
Snrnp200 C T 2: 127,233,066 P1520S possibly damaging Het
Taar7a T A 10: 23,992,458 T342S probably benign Het
Tecpr2 A T 12: 110,933,015 I606F probably benign Het
Tex19.2 A T 11: 121,117,478 M48K probably benign Het
Thoc1 A G 18: 9,992,204 T511A probably benign Het
Trpc2 GTGTCCTA GTGTCCTATGTCCTA 7: 102,095,213 probably null Het
Ubr5 C A 15: 38,008,739 A1077S probably benign Het
Wdr95 A T 5: 149,596,330 R571* probably null Het
Other mutations in Skor2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01476:Skor2 APN 18 76858667 missense unknown
IGL01604:Skor2 APN 18 76859951 missense possibly damaging 0.93
IGL02306:Skor2 APN 18 76862679 missense probably benign 0.01
IGL03287:Skor2 APN 18 76876135 missense probably damaging 0.99
R0225:Skor2 UTSW 18 76859098 missense unknown
R0265:Skor2 UTSW 18 76876598 missense probably damaging 0.99
R0650:Skor2 UTSW 18 76876560 missense probably benign 0.32
R1086:Skor2 UTSW 18 76859299 missense unknown
R1237:Skor2 UTSW 18 76876132 nonsense probably null
R1465:Skor2 UTSW 18 76876645 splice site probably benign
R1625:Skor2 UTSW 18 76858804 missense unknown
R1682:Skor2 UTSW 18 76859516 missense unknown
R1918:Skor2 UTSW 18 76859356 missense unknown
R2878:Skor2 UTSW 18 76860724 nonsense probably null
R3103:Skor2 UTSW 18 76859278 nonsense probably null
R3611:Skor2 UTSW 18 76858838 missense unknown
R3882:Skor2 UTSW 18 76862689 missense probably damaging 0.97
R3891:Skor2 UTSW 18 76858655 missense unknown
R4473:Skor2 UTSW 18 76859461 missense unknown
R4720:Skor2 UTSW 18 76861183 critical splice donor site probably null
R4828:Skor2 UTSW 18 76860418 missense probably damaging 1.00
R4906:Skor2 UTSW 18 76860295 missense possibly damaging 0.73
R5074:Skor2 UTSW 18 76858954 nonsense probably null
R5729:Skor2 UTSW 18 76858883 missense unknown
R5886:Skor2 UTSW 18 76859429 missense unknown
R6017:Skor2 UTSW 18 76858927 missense unknown
R6514:Skor2 UTSW 18 76862694 missense probably damaging 1.00
R6565:Skor2 UTSW 18 76859912 missense possibly damaging 0.70
R6909:Skor2 UTSW 18 76860557 missense possibly damaging 0.68
R7169:Skor2 UTSW 18 76860986 missense probably benign 0.04
R7171:Skor2 UTSW 18 76860986 missense probably benign 0.04
R7188:Skor2 UTSW 18 76859809 missense possibly damaging 0.53
R7219:Skor2 UTSW 18 76860401 missense possibly damaging 0.96
R7548:Skor2 UTSW 18 76860905 missense possibly damaging 0.82
R7722:Skor2 UTSW 18 76862644 missense probably benign 0.09
R8125:Skor2 UTSW 18 76859678 missense unknown
R8255:Skor2 UTSW 18 76858969 missense unknown
RF015:Skor2 UTSW 18 76860788 missense probably damaging 0.99
Z1176:Skor2 UTSW 18 76860124 missense probably benign 0.15
Z1176:Skor2 UTSW 18 76860670 missense possibly damaging 0.93
Z1176:Skor2 UTSW 18 76861161 missense probably damaging 0.99
Z1177:Skor2 UTSW 18 76876093 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CCCCTCTGTCTTAAAACAGGAAAGG -3'
(R):5'- AGTTGGACAGGTGTGCACTG -3'

Sequencing Primer
(F):5'- GGAAAGGTTCAAGTCAACTTTCTCC -3'
(R):5'- TGAGAAGAGTGTTGGAGATC -3'
Posted On2016-10-05