Incidental Mutation 'R5486:Add3'
ID430392
Institutional Source Beutler Lab
Gene Symbol Add3
Ensembl Gene ENSMUSG00000025026
Gene Nameadducin 3 (gamma)
Synonyms
MMRRC Submission 043047-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5486 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location53140445-53247399 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 53244387 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 604 (V604I)
Ref Sequence ENSEMBL: ENSMUSP00000107370 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025999] [ENSMUST00000050096] [ENSMUST00000111741]
Predicted Effect probably benign
Transcript: ENSMUST00000025999
AA Change: V604I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000025999
Gene: ENSMUSG00000025026
AA Change: V604I

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
low complexity region 101 114 N/A INTRINSIC
Aldolase_II 139 321 1.62e-46 SMART
coiled coil region 556 582 N/A INTRINSIC
low complexity region 590 605 N/A INTRINSIC
low complexity region 650 662 N/A INTRINSIC
low complexity region 673 703 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000050096
SMART Domains Protein: ENSMUSP00000052245
Gene: ENSMUSG00000025026

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
low complexity region 101 114 N/A INTRINSIC
Aldolase_II 139 321 1.62e-46 SMART
low complexity region 618 630 N/A INTRINSIC
low complexity region 641 671 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111741
AA Change: V604I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000107370
Gene: ENSMUSG00000025026
AA Change: V604I

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
low complexity region 101 114 N/A INTRINSIC
Aldolase_II 139 321 1.62e-46 SMART
coiled coil region 556 582 N/A INTRINSIC
low complexity region 590 605 N/A INTRINSIC
low complexity region 650 662 N/A INTRINSIC
low complexity region 673 703 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.2%
  • 10x: 95.1%
  • 20x: 90.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Adducins are heteromeric proteins composed of different subunits referred to as adducin alpha, beta and gamma. The three subunits are encoded by distinct genes and belong to a family of membrane skeletal proteins involved in the assembly of spectrin-actin network in erythrocytes and at sites of cell-cell contact in epithelial tissues. While adducins alpha and gamma are ubiquitously expressed, the expression of adducin beta is restricted to brain and hematopoietic tissues. Adducin, originally purified from human erythrocytes, was found to be a heterodimer of adducins alpha and beta. Polymorphisms resulting in amino acid substitutions in these two subunits have been associated with the regulation of blood pressure in an animal model of hypertension. Heterodimers consisting of alpha and gamma subunits have also been described. Structurally, each subunit is comprised of two distinct domains. The amino-terminal region is protease resistant and globular in shape, while the carboxy-terminal region is protease sensitive. The latter contains multiple phosphorylation sites for protein kinase C, the binding site for calmodulin, and is required for association with spectrin and actin. Alternatively spliced adducin gamma transcripts encoding different isoforms have been described. The functions of the different isoforms are not known. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal blood pressure and show no significant alterations in red blood cell or platelet structure and function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930009A15Rik G T 10: 115,579,905 probably benign Het
Acad8 A T 9: 26,999,495 M1K probably null Het
Adam12 C A 7: 133,907,672 R786S possibly damaging Het
Alpk2 A T 18: 65,294,354 probably null Het
Ano3 T C 2: 110,745,870 D102G probably damaging Het
Bdp1 T C 13: 100,098,510 Y192C probably damaging Het
Bod1l A T 5: 41,807,181 D2693E possibly damaging Het
Ccdc7a T C 8: 128,985,403 N284D probably damaging Het
Clic6 A G 16: 92,529,852 probably null Het
Cln5 T C 14: 103,076,194 I294T probably damaging Het
Cmklr1 C G 5: 113,614,929 D4H possibly damaging Het
Cyp2d9 T A 15: 82,452,578 W43R probably damaging Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Erlec1 A T 11: 30,935,047 H413Q probably damaging Het
Fam168a T A 7: 100,834,169 M203K probably damaging Het
Fat2 A T 11: 55,253,681 S4122R probably benign Het
Fgd4 A T 16: 16,475,037 L272Q probably damaging Het
Hpcal4 A G 4: 123,190,764 K162R probably benign Het
Iars T A 13: 49,709,573 probably null Het
Lbr A G 1: 181,818,838 probably null Het
Lrp2 T C 2: 69,437,465 I4259V probably benign Het
Mcm3 C T 1: 20,814,894 G189S probably damaging Het
Nr1d2 A G 14: 18,206,860 V137A possibly damaging Het
Olfr646 C A 7: 104,106,498 T73N probably damaging Het
Olfr665 T A 7: 104,880,961 C85S probably benign Het
Olfr853 A G 9: 19,537,294 V212A probably benign Het
Pim3 T C 15: 88,863,222 V97A possibly damaging Het
Piwil2 T C 14: 70,401,431 N479S probably benign Het
Pld3 C A 7: 27,533,731 W365L probably damaging Het
Plk3 C A 4: 117,130,403 E412* probably null Het
Psmd1 A G 1: 86,137,050 I935V possibly damaging Het
Sh2b2 A G 5: 136,232,090 S91P probably benign Het
Skor2 A G 18: 76,858,700 N39S unknown Het
Slc22a22 A G 15: 57,263,451 V55A probably damaging Het
Smg7 A G 1: 152,846,176 S595P probably damaging Het
Snrnp200 C T 2: 127,233,066 P1520S possibly damaging Het
Taar7a T A 10: 23,992,458 T342S probably benign Het
Tecpr2 A T 12: 110,933,015 I606F probably benign Het
Tex19.2 A T 11: 121,117,478 M48K probably benign Het
Thoc1 A G 18: 9,992,204 T511A probably benign Het
Trpc2 GTGTCCTA GTGTCCTATGTCCTA 7: 102,095,213 probably null Het
Ubr5 C A 15: 38,008,739 A1077S probably benign Het
Wdr95 A T 5: 149,596,330 R571* probably null Het
Other mutations in Add3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01744:Add3 APN 19 53239430 missense probably damaging 1.00
IGL02177:Add3 APN 19 53216892 nonsense probably null
IGL03093:Add3 APN 19 53231207 missense probably damaging 1.00
IGL03047:Add3 UTSW 19 53242591 missense probably benign 0.00
PIT4243001:Add3 UTSW 19 53236690 missense probably benign 0.00
PIT4366001:Add3 UTSW 19 53216867 missense unknown
R0087:Add3 UTSW 19 53226607 missense probably damaging 1.00
R0335:Add3 UTSW 19 53236828 missense probably benign 0.00
R0346:Add3 UTSW 19 53216956 nonsense probably null
R0514:Add3 UTSW 19 53236843 nonsense probably null
R0692:Add3 UTSW 19 53216952 missense probably damaging 1.00
R1437:Add3 UTSW 19 53233678 missense probably damaging 0.98
R1747:Add3 UTSW 19 53242550 missense probably benign 0.41
R2926:Add3 UTSW 19 53226822 intron probably null
R4192:Add3 UTSW 19 53242524 missense probably benign 0.00
R4780:Add3 UTSW 19 53234792 missense possibly damaging 0.64
R5019:Add3 UTSW 19 53242571 missense probably damaging 0.99
R5526:Add3 UTSW 19 53226607 missense probably damaging 1.00
R5580:Add3 UTSW 19 53245211 missense probably damaging 1.00
R5851:Add3 UTSW 19 53236774 missense probably damaging 1.00
R5863:Add3 UTSW 19 53233870 missense probably benign 0.00
R5951:Add3 UTSW 19 53244289 intron probably null
R6229:Add3 UTSW 19 53234846 missense probably benign 0.35
R7017:Add3 UTSW 19 53233853 missense possibly damaging 0.94
R7190:Add3 UTSW 19 53216899 nonsense probably null
R7222:Add3 UTSW 19 53216846 missense unknown
R7231:Add3 UTSW 19 53233146 missense probably benign 0.00
R7532:Add3 UTSW 19 53232158 missense probably damaging 1.00
R7557:Add3 UTSW 19 53239437 missense probably damaging 0.98
R7726:Add3 UTSW 19 53239461 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGCTCAGTTCTCAGCTGAC -3'
(R):5'- ATAGGTTGACCCAAGCCAGG -3'

Sequencing Primer
(F):5'- CGCACTAACCTCTCTGAA -3'
(R):5'- CCAAGCCAGGCGAGTGAATTC -3'
Posted On2016-10-05