Incidental Mutation 'R5486:Add3'
ID 430392
Institutional Source Beutler Lab
Gene Symbol Add3
Ensembl Gene ENSMUSG00000025026
Gene Name adducin 3
Synonyms
MMRRC Submission 043047-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5486 (G1)
Quality Score 225
Status Not validated
Chromosome 19
Chromosomal Location 53128874-53235518 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 53232818 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 604 (V604I)
Ref Sequence ENSEMBL: ENSMUSP00000107370 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025999] [ENSMUST00000050096] [ENSMUST00000111741]
AlphaFold Q9QYB5
Predicted Effect probably benign
Transcript: ENSMUST00000025999
AA Change: V604I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000025999
Gene: ENSMUSG00000025026
AA Change: V604I

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
low complexity region 101 114 N/A INTRINSIC
Aldolase_II 139 321 1.62e-46 SMART
coiled coil region 556 582 N/A INTRINSIC
low complexity region 590 605 N/A INTRINSIC
low complexity region 650 662 N/A INTRINSIC
low complexity region 673 703 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000050096
SMART Domains Protein: ENSMUSP00000052245
Gene: ENSMUSG00000025026

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
low complexity region 101 114 N/A INTRINSIC
Aldolase_II 139 321 1.62e-46 SMART
low complexity region 618 630 N/A INTRINSIC
low complexity region 641 671 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111741
AA Change: V604I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000107370
Gene: ENSMUSG00000025026
AA Change: V604I

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
low complexity region 101 114 N/A INTRINSIC
Aldolase_II 139 321 1.62e-46 SMART
coiled coil region 556 582 N/A INTRINSIC
low complexity region 590 605 N/A INTRINSIC
low complexity region 650 662 N/A INTRINSIC
low complexity region 673 703 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.2%
  • 10x: 95.1%
  • 20x: 90.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Adducins are heteromeric proteins composed of different subunits referred to as adducin alpha, beta and gamma. The three subunits are encoded by distinct genes and belong to a family of membrane skeletal proteins involved in the assembly of spectrin-actin network in erythrocytes and at sites of cell-cell contact in epithelial tissues. While adducins alpha and gamma are ubiquitously expressed, the expression of adducin beta is restricted to brain and hematopoietic tissues. Adducin, originally purified from human erythrocytes, was found to be a heterodimer of adducins alpha and beta. Polymorphisms resulting in amino acid substitutions in these two subunits have been associated with the regulation of blood pressure in an animal model of hypertension. Heterodimers consisting of alpha and gamma subunits have also been described. Structurally, each subunit is comprised of two distinct domains. The amino-terminal region is protease resistant and globular in shape, while the carboxy-terminal region is protease sensitive. The latter contains multiple phosphorylation sites for protein kinase C, the binding site for calmodulin, and is required for association with spectrin and actin. Alternatively spliced adducin gamma transcripts encoding different isoforms have been described. The functions of the different isoforms are not known. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal blood pressure and show no significant alterations in red blood cell or platelet structure and function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930009A15Rik G T 10: 115,415,810 (GRCm39) probably benign Het
Acad8 A T 9: 26,910,791 (GRCm39) M1K probably null Het
Adam12 C A 7: 133,509,401 (GRCm39) R786S possibly damaging Het
Alpk2 A T 18: 65,427,425 (GRCm39) probably null Het
Ano3 T C 2: 110,576,215 (GRCm39) D102G probably damaging Het
Bdp1 T C 13: 100,235,018 (GRCm39) Y192C probably damaging Het
Bod1l A T 5: 41,964,524 (GRCm39) D2693E possibly damaging Het
Ccdc7a T C 8: 129,711,884 (GRCm39) N284D probably damaging Het
Clic6 A G 16: 92,326,740 (GRCm39) probably null Het
Cln5 T C 14: 103,313,630 (GRCm39) I294T probably damaging Het
Cmklr1 C G 5: 113,752,990 (GRCm39) D4H possibly damaging Het
Cyp2d9 T A 15: 82,336,779 (GRCm39) W43R probably damaging Het
Dnajb12 GC G 10: 59,728,574 (GRCm39) probably null Het
Erlec1 A T 11: 30,885,047 (GRCm39) H413Q probably damaging Het
Fam168a T A 7: 100,483,376 (GRCm39) M203K probably damaging Het
Fat2 A T 11: 55,144,507 (GRCm39) S4122R probably benign Het
Fgd4 A T 16: 16,292,901 (GRCm39) L272Q probably damaging Het
Hpcal4 A G 4: 123,084,557 (GRCm39) K162R probably benign Het
Iars1 T A 13: 49,863,049 (GRCm39) probably null Het
Lbr A G 1: 181,646,403 (GRCm39) probably null Het
Lrp2 T C 2: 69,267,809 (GRCm39) I4259V probably benign Het
Mcm3 C T 1: 20,885,118 (GRCm39) G189S probably damaging Het
Nr1d2 A G 14: 18,206,860 (GRCm38) V137A possibly damaging Het
Or52d1 C A 7: 103,755,705 (GRCm39) T73N probably damaging Het
Or52n3 T A 7: 104,530,168 (GRCm39) C85S probably benign Het
Or7g33 A G 9: 19,448,590 (GRCm39) V212A probably benign Het
Pim3 T C 15: 88,747,425 (GRCm39) V97A possibly damaging Het
Piwil2 T C 14: 70,638,880 (GRCm39) N479S probably benign Het
Pld3 C A 7: 27,233,156 (GRCm39) W365L probably damaging Het
Plk3 C A 4: 116,987,600 (GRCm39) E412* probably null Het
Psmd1 A G 1: 86,064,772 (GRCm39) I935V possibly damaging Het
Sh2b2 A G 5: 136,260,944 (GRCm39) S91P probably benign Het
Skor2 A G 18: 76,946,395 (GRCm39) N39S unknown Het
Slc22a22 A G 15: 57,126,847 (GRCm39) V55A probably damaging Het
Smg7 A G 1: 152,721,927 (GRCm39) S595P probably damaging Het
Snrnp200 C T 2: 127,074,986 (GRCm39) P1520S possibly damaging Het
Taar7a T A 10: 23,868,356 (GRCm39) T342S probably benign Het
Tecpr2 A T 12: 110,899,449 (GRCm39) I606F probably benign Het
Tex19.2 A T 11: 121,008,304 (GRCm39) M48K probably benign Het
Thoc1 A G 18: 9,992,204 (GRCm39) T511A probably benign Het
Trpc2 GTGTCCTA GTGTCCTATGTCCTA 7: 101,744,420 (GRCm39) probably null Het
Ubr5 C A 15: 38,008,983 (GRCm39) A1077S probably benign Het
Wdr95 A T 5: 149,519,795 (GRCm39) R571* probably null Het
Other mutations in Add3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01744:Add3 APN 19 53,227,861 (GRCm39) missense probably damaging 1.00
IGL02177:Add3 APN 19 53,205,323 (GRCm39) nonsense probably null
IGL03093:Add3 APN 19 53,219,638 (GRCm39) missense probably damaging 1.00
IGL03047:Add3 UTSW 19 53,231,022 (GRCm39) missense probably benign 0.00
PIT4243001:Add3 UTSW 19 53,225,121 (GRCm39) missense probably benign 0.00
PIT4366001:Add3 UTSW 19 53,205,298 (GRCm39) missense unknown
R0087:Add3 UTSW 19 53,215,038 (GRCm39) missense probably damaging 1.00
R0335:Add3 UTSW 19 53,225,259 (GRCm39) missense probably benign 0.00
R0346:Add3 UTSW 19 53,205,387 (GRCm39) nonsense probably null
R0514:Add3 UTSW 19 53,225,274 (GRCm39) nonsense probably null
R0692:Add3 UTSW 19 53,205,383 (GRCm39) missense probably damaging 1.00
R1437:Add3 UTSW 19 53,222,109 (GRCm39) missense probably damaging 0.98
R1747:Add3 UTSW 19 53,230,981 (GRCm39) missense probably benign 0.41
R2926:Add3 UTSW 19 53,215,253 (GRCm39) splice site probably null
R4192:Add3 UTSW 19 53,230,955 (GRCm39) missense probably benign 0.00
R4780:Add3 UTSW 19 53,223,223 (GRCm39) missense possibly damaging 0.64
R5019:Add3 UTSW 19 53,231,002 (GRCm39) missense probably damaging 0.99
R5526:Add3 UTSW 19 53,215,038 (GRCm39) missense probably damaging 1.00
R5580:Add3 UTSW 19 53,233,642 (GRCm39) missense probably damaging 1.00
R5851:Add3 UTSW 19 53,225,205 (GRCm39) missense probably damaging 1.00
R5863:Add3 UTSW 19 53,222,301 (GRCm39) missense probably benign 0.00
R5951:Add3 UTSW 19 53,232,720 (GRCm39) splice site probably null
R6229:Add3 UTSW 19 53,223,277 (GRCm39) missense probably benign 0.35
R7017:Add3 UTSW 19 53,222,284 (GRCm39) missense possibly damaging 0.94
R7190:Add3 UTSW 19 53,205,330 (GRCm39) nonsense probably null
R7222:Add3 UTSW 19 53,205,277 (GRCm39) missense unknown
R7231:Add3 UTSW 19 53,221,577 (GRCm39) missense probably benign 0.00
R7532:Add3 UTSW 19 53,220,589 (GRCm39) missense probably damaging 1.00
R7557:Add3 UTSW 19 53,227,868 (GRCm39) missense probably damaging 0.98
R7726:Add3 UTSW 19 53,227,892 (GRCm39) missense probably damaging 1.00
R9063:Add3 UTSW 19 53,222,302 (GRCm39) missense probably damaging 0.98
R9069:Add3 UTSW 19 53,222,332 (GRCm39) missense possibly damaging 0.92
R9371:Add3 UTSW 19 53,221,499 (GRCm39) missense probably damaging 1.00
R9550:Add3 UTSW 19 53,233,521 (GRCm39) missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- ATGCTCAGTTCTCAGCTGAC -3'
(R):5'- ATAGGTTGACCCAAGCCAGG -3'

Sequencing Primer
(F):5'- CGCACTAACCTCTCTGAA -3'
(R):5'- CCAAGCCAGGCGAGTGAATTC -3'
Posted On 2016-10-05