Incidental Mutation 'R5487:Lrriq4'
ID430397
Institutional Source Beutler Lab
Gene Symbol Lrriq4
Ensembl Gene ENSMUSG00000027703
Gene Nameleucine-rich repeats and IQ motif containing 4
Synonyms4930558O21Rik
MMRRC Submission 043048-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R5487 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location30644507-30672431 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 30659995 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 497 (N497K)
Ref Sequence ENSEMBL: ENSMUSP00000103900 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108265] [ENSMUST00000108267] [ENSMUST00000172350]
Predicted Effect probably benign
Transcript: ENSMUST00000108265
AA Change: N497K

PolyPhen 2 Score 0.162 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000103900
Gene: ENSMUSG00000027703
AA Change: N497K

DomainStartEndE-ValueType
LRR 68 90 7.05e-1 SMART
LRR 91 114 1.19e1 SMART
Pfam:LRR_7 115 133 1.1e-1 PFAM
LRR 138 161 9.75e0 SMART
LRR 162 185 8.72e0 SMART
LRR 208 230 3.47e0 SMART
LRR 231 254 9.3e-1 SMART
LRR 255 276 1.22e2 SMART
LRR 277 300 4.83e0 SMART
LRR 323 345 6.22e0 SMART
LRR 346 368 6.4e0 SMART
LRR 369 392 1.51e0 SMART
LRR 418 440 2.03e1 SMART
LRR 441 464 2.82e0 SMART
IQ 524 546 8.84e-3 SMART
low complexity region 553 581 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108267
AA Change: N512K

PolyPhen 2 Score 0.101 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000103902
Gene: ENSMUSG00000027703
AA Change: N512K

DomainStartEndE-ValueType
LRR 83 105 7.05e-1 SMART
LRR 106 129 1.19e1 SMART
Pfam:LRR_7 130 148 1.2e-1 PFAM
LRR 153 176 9.75e0 SMART
LRR 177 200 8.72e0 SMART
LRR 223 245 3.47e0 SMART
LRR 246 269 9.3e-1 SMART
LRR 270 291 1.22e2 SMART
LRR 292 315 4.83e0 SMART
LRR 338 360 6.22e0 SMART
LRR 361 383 6.4e0 SMART
LRR 384 407 1.51e0 SMART
LRR 433 455 2.03e1 SMART
LRR 456 479 2.82e0 SMART
IQ 539 561 8.84e-3 SMART
low complexity region 568 596 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172350
AA Change: N512K

PolyPhen 2 Score 0.101 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000127052
Gene: ENSMUSG00000027703
AA Change: N512K

DomainStartEndE-ValueType
LRR 83 105 7.05e-1 SMART
LRR 106 129 1.19e1 SMART
LRR 153 176 9.75e0 SMART
LRR 177 200 8.72e0 SMART
LRR 223 245 3.47e0 SMART
LRR 246 269 9.3e-1 SMART
LRR 270 291 1.22e2 SMART
LRR 292 315 4.83e0 SMART
LRR 338 360 6.22e0 SMART
LRR 361 383 6.4e0 SMART
LRR 384 407 1.51e0 SMART
LRR 433 455 2.03e1 SMART
LRR 456 479 2.82e0 SMART
IQ 539 561 8.84e-3 SMART
low complexity region 568 596 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.1%
  • 10x: 94.6%
  • 20x: 89.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b A G 11: 109,953,514 V959A probably damaging Het
AI314180 T C 4: 58,809,421 D1651G probably benign Het
Alg3 A T 16: 20,607,780 I115N probably damaging Het
Ash1l A G 3: 88,981,426 D204G probably benign Het
Camta1 C A 4: 151,144,754 E540D possibly damaging Het
Cblc T C 7: 19,784,808 T413A probably benign Het
Ccdc122 T A 14: 77,091,679 H57Q probably benign Het
Ccdc85a A T 11: 28,576,768 L280* probably null Het
Cd46 T G 1: 195,068,170 probably null Het
Cmklr1 C G 5: 113,614,929 D4H possibly damaging Het
Dnaaf3 T C 7: 4,523,865 probably null Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Eif2ak1 A G 5: 143,897,163 probably null Het
Erich4 A G 7: 25,615,239 M83T probably benign Het
Fbxo24 C T 5: 137,618,832 G331E possibly damaging Het
Fzd4 A G 7: 89,407,407 I221V probably benign Het
G6pc2 T C 2: 69,226,577 V189A probably damaging Het
Gm10663 A C 8: 65,075,034 E1A probably null Het
Gm4871 C A 5: 145,030,389 E178D probably damaging Het
Igdcc3 A G 9: 65,181,584 E415G probably damaging Het
Kmt2a A T 9: 44,821,975 probably benign Het
Krba1 T C 6: 48,404,039 V103A probably damaging Het
Lcat T C 8: 105,939,664 K409E probably benign Het
Mical2 A G 7: 112,320,635 T451A probably damaging Het
Noxo1 C T 17: 24,698,317 probably benign Het
Oas1a A G 5: 120,907,427 I17T probably damaging Het
Otog A T 7: 46,288,768 Y1967F probably benign Het
Pcdha9 A T 18: 36,999,650 N591Y probably damaging Het
Plxna4 A G 6: 32,517,283 Y133H probably damaging Het
Pou5f2 T C 13: 78,024,999 L20P probably benign Het
Prkcb T A 7: 122,600,725 C586* probably null Het
Sema3b A T 9: 107,600,962 M408K probably damaging Het
Serpinf2 G A 11: 75,433,205 T332I probably damaging Het
Tmbim1 A G 1: 74,293,005 V121A probably benign Het
Tph2 C T 10: 115,119,874 G338D probably damaging Het
Trpc2 GTGTCCTA GTGTCCTATGTCCTA 7: 102,095,213 probably null Het
Ttn C T 2: 76,812,552 V13247M probably damaging Het
Uty C T Y: 1,174,825 G192R probably damaging Het
Vmn2r65 G T 7: 84,946,321 P385Q possibly damaging Het
Wdfy3 G A 5: 101,836,274 R3489W probably damaging Het
Zfp750 A G 11: 121,513,732 S106P probably benign Het
Other mutations in Lrriq4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Lrriq4 APN 3 30650955 splice site probably null
IGL01289:Lrriq4 APN 3 30650393 missense probably damaging 1.00
IGL02130:Lrriq4 APN 3 30650747 missense probably damaging 0.99
IGL02614:Lrriq4 APN 3 30655639 missense probably damaging 1.00
R0329:Lrriq4 UTSW 3 30655724 missense probably benign 0.03
R1340:Lrriq4 UTSW 3 30650323 missense possibly damaging 0.46
R1440:Lrriq4 UTSW 3 30650761 missense probably damaging 1.00
R1446:Lrriq4 UTSW 3 30650578 missense probably benign 0.00
R1597:Lrriq4 UTSW 3 30650888 missense probably damaging 1.00
R1763:Lrriq4 UTSW 3 30650252 missense probably benign 0.19
R1923:Lrriq4 UTSW 3 30659093 missense probably benign 0.13
R4024:Lrriq4 UTSW 3 30650273 missense possibly damaging 0.46
R4026:Lrriq4 UTSW 3 30650273 missense possibly damaging 0.46
R4645:Lrriq4 UTSW 3 30650743 missense probably benign 0.20
R4816:Lrriq4 UTSW 3 30660047 missense possibly damaging 0.73
R5049:Lrriq4 UTSW 3 30650937 missense probably damaging 0.97
R5105:Lrriq4 UTSW 3 30650483 missense probably damaging 1.00
R5298:Lrriq4 UTSW 3 30645332 start codon destroyed probably null
R6147:Lrriq4 UTSW 3 30659079 missense probably damaging 1.00
R6421:Lrriq4 UTSW 3 30650402 missense probably damaging 1.00
R6452:Lrriq4 UTSW 3 30655733 missense probably damaging 1.00
R6624:Lrriq4 UTSW 3 30650780 missense probably benign 0.01
R7032:Lrriq4 UTSW 3 30655701 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCTATGGGTTCTGGTACTTCCC -3'
(R):5'- AAGGGGTGTTTATTATCAAGATGC -3'

Sequencing Primer
(F):5'- ATCCTCTTACCAATGGATCTCAC -3'
(R):5'- GTGGTGGCCATCATTTTC -3'
Posted On2016-10-05