Incidental Mutation 'R5487:Oas1a'
ID430403
Institutional Source Beutler Lab
Gene Symbol Oas1a
Ensembl Gene ENSMUSG00000052776
Gene Name2'-5' oligoadenylate synthetase 1A
SynonymsL3
MMRRC Submission 043048-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5487 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location120896256-120907521 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 120907427 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 17 (I17T)
Ref Sequence ENSEMBL: ENSMUSP00000079198 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080322]
Predicted Effect probably damaging
Transcript: ENSMUST00000080322
AA Change: I17T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000079198
Gene: ENSMUSG00000052776
AA Change: I17T

DomainStartEndE-ValueType
Pfam:NTP_transf_2 38 139 9.8e-14 PFAM
Pfam:OAS1_C 164 349 1.9e-87 PFAM
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.1%
  • 10x: 94.6%
  • 20x: 89.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b A G 11: 109,953,514 V959A probably damaging Het
AI314180 T C 4: 58,809,421 D1651G probably benign Het
Alg3 A T 16: 20,607,780 I115N probably damaging Het
Ash1l A G 3: 88,981,426 D204G probably benign Het
Camta1 C A 4: 151,144,754 E540D possibly damaging Het
Cblc T C 7: 19,784,808 T413A probably benign Het
Ccdc122 T A 14: 77,091,679 H57Q probably benign Het
Ccdc85a A T 11: 28,576,768 L280* probably null Het
Cd46 T G 1: 195,068,170 probably null Het
Cmklr1 C G 5: 113,614,929 D4H possibly damaging Het
Dnaaf3 T C 7: 4,523,865 probably null Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Eif2ak1 A G 5: 143,897,163 probably null Het
Erich4 A G 7: 25,615,239 M83T probably benign Het
Fbxo24 C T 5: 137,618,832 G331E possibly damaging Het
Fzd4 A G 7: 89,407,407 I221V probably benign Het
G6pc2 T C 2: 69,226,577 V189A probably damaging Het
Gm10663 A C 8: 65,075,034 E1A probably null Het
Gm4871 C A 5: 145,030,389 E178D probably damaging Het
Igdcc3 A G 9: 65,181,584 E415G probably damaging Het
Kmt2a A T 9: 44,821,975 probably benign Het
Krba1 T C 6: 48,404,039 V103A probably damaging Het
Lcat T C 8: 105,939,664 K409E probably benign Het
Lrriq4 C A 3: 30,659,995 N497K probably benign Het
Mical2 A G 7: 112,320,635 T451A probably damaging Het
Noxo1 C T 17: 24,698,317 probably benign Het
Otog A T 7: 46,288,768 Y1967F probably benign Het
Pcdha9 A T 18: 36,999,650 N591Y probably damaging Het
Plxna4 A G 6: 32,517,283 Y133H probably damaging Het
Pou5f2 T C 13: 78,024,999 L20P probably benign Het
Prkcb T A 7: 122,600,725 C586* probably null Het
Sema3b A T 9: 107,600,962 M408K probably damaging Het
Serpinf2 G A 11: 75,433,205 T332I probably damaging Het
Tmbim1 A G 1: 74,293,005 V121A probably benign Het
Tph2 C T 10: 115,119,874 G338D probably damaging Het
Trpc2 GTGTCCTA GTGTCCTATGTCCTA 7: 102,095,213 probably null Het
Ttn C T 2: 76,812,552 V13247M probably damaging Het
Uty C T Y: 1,174,825 G192R probably damaging Het
Vmn2r65 G T 7: 84,946,321 P385Q possibly damaging Het
Wdfy3 G A 5: 101,836,274 R3489W probably damaging Het
Zfp750 A G 11: 121,513,732 S106P probably benign Het
Other mutations in Oas1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01822:Oas1a APN 5 120899214 missense probably benign 0.01
IGL02299:Oas1a APN 5 120905692 missense probably benign
IGL02951:Oas1a APN 5 120905664 missense probably damaging 1.00
IGL03112:Oas1a APN 5 120898349 missense possibly damaging 0.95
IGL03230:Oas1a APN 5 120898356 missense probably benign 0.23
IGL03356:Oas1a APN 5 120905845 missense probably damaging 0.99
IGL03379:Oas1a APN 5 120896999 missense possibly damaging 0.70
R0625:Oas1a UTSW 5 120899259 missense probably damaging 1.00
R1279:Oas1a UTSW 5 120897178 critical splice donor site probably null
R1914:Oas1a UTSW 5 120905813 missense possibly damaging 0.48
R1915:Oas1a UTSW 5 120905813 missense possibly damaging 0.48
R4758:Oas1a UTSW 5 120907338 missense probably damaging 1.00
R4928:Oas1a UTSW 5 120905724 missense probably benign
R5267:Oas1a UTSW 5 120899221 missense probably benign 0.00
R5442:Oas1a UTSW 5 120897206 missense probably benign 0.00
R6853:Oas1a UTSW 5 120907428 missense possibly damaging 0.95
R6880:Oas1a UTSW 5 120901940 missense probably damaging 0.97
R8043:Oas1a UTSW 5 120897017 missense not run
Z1177:Oas1a UTSW 5 120901895 missense not run
Predicted Primers PCR Primer
(F):5'- TGTCTGGCTTCTGAGAGTCC -3'
(R):5'- AGCTCAGACTTCAAAGAACCTG -3'

Sequencing Primer
(F):5'- GGCTTCTGAGAGTCCCCTCC -3'
(R):5'- TCAGACTTCAAAGAACCTGGTCAG -3'
Posted On2016-10-05