Incidental Mutation 'R5487:Krba1'
ID430407
Institutional Source Beutler Lab
Gene Symbol Krba1
Ensembl Gene ENSMUSG00000042810
Gene NameKRAB-A domain containing 1
SynonymsA930040G15Rik
MMRRC Submission 043048-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R5487 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location48395586-48419781 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 48404039 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 103 (V103A)
Ref Sequence ENSEMBL: ENSMUSP00000110219 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031815] [ENSMUST00000077093] [ENSMUST00000114571] [ENSMUST00000114572] [ENSMUST00000203371]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031815
AA Change: V124A

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000031815
Gene: ENSMUSG00000042810
AA Change: V124A

DomainStartEndE-ValueType
low complexity region 31 43 N/A INTRINSIC
KRBA1 154 197 1.27e-3 SMART
KRBA1 249 291 3.23e-14 SMART
KRBA1 310 355 8.27e-12 SMART
KRBA1 357 399 4.98e-6 SMART
low complexity region 452 459 N/A INTRINSIC
KRBA1 474 516 6.03e-14 SMART
KRBA1 576 619 7.71e-12 SMART
coiled coil region 814 847 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000077093
AA Change: V68A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000076345
Gene: ENSMUSG00000042810
AA Change: V68A

DomainStartEndE-ValueType
Blast:KRAB 1 34 2e-12 BLAST
KRBA1 98 141 1.27e-3 SMART
KRBA1 193 235 3.23e-14 SMART
KRBA1 254 299 8.27e-12 SMART
KRBA1 367 409 7.26e-8 SMART
low complexity region 462 469 N/A INTRINSIC
KRBA1 484 526 6.03e-14 SMART
KRBA1 586 629 7.71e-12 SMART
coiled coil region 824 857 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114571
AA Change: V68A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110218
Gene: ENSMUSG00000042810
AA Change: V68A

DomainStartEndE-ValueType
Blast:KRAB 1 34 2e-12 BLAST
KRBA1 98 141 1.27e-3 SMART
KRBA1 193 235 3.23e-14 SMART
KRBA1 254 299 8.27e-12 SMART
KRBA1 367 409 7.26e-8 SMART
low complexity region 462 469 N/A INTRINSIC
KRBA1 484 526 6.03e-14 SMART
KRBA1 586 629 7.71e-12 SMART
coiled coil region 824 857 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114572
AA Change: V103A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110219
Gene: ENSMUSG00000042810
AA Change: V103A

DomainStartEndE-ValueType
Blast:KRAB 1 34 2e-12 BLAST
KRBA1 98 141 1.27e-3 SMART
KRBA1 194 236 3.23e-14 SMART
KRBA1 255 300 8.27e-12 SMART
KRBA1 368 410 7.26e-8 SMART
low complexity region 463 470 N/A INTRINSIC
KRBA1 485 527 6.03e-14 SMART
KRBA1 587 630 7.71e-12 SMART
coiled coil region 825 858 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127980
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148697
Predicted Effect probably benign
Transcript: ENSMUST00000203371
AA Change: V68A

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000145256
Gene: ENSMUSG00000042810
AA Change: V68A

DomainStartEndE-ValueType
Blast:KRAB 1 34 2e-12 BLAST
KRBA1 97 140 8.1e-8 SMART
KRBA1 193 235 2.5e-18 SMART
KRBA1 254 299 6.4e-16 SMART
KRBA1 367 409 5.7e-12 SMART
low complexity region 462 469 N/A INTRINSIC
KRBA1 484 526 4.6e-18 SMART
KRBA1 586 629 5.8e-16 SMART
coiled coil region 824 857 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204308
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.1%
  • 10x: 94.6%
  • 20x: 89.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b A G 11: 109,953,514 V959A probably damaging Het
AI314180 T C 4: 58,809,421 D1651G probably benign Het
Alg3 A T 16: 20,607,780 I115N probably damaging Het
Ash1l A G 3: 88,981,426 D204G probably benign Het
Camta1 C A 4: 151,144,754 E540D possibly damaging Het
Cblc T C 7: 19,784,808 T413A probably benign Het
Ccdc122 T A 14: 77,091,679 H57Q probably benign Het
Ccdc85a A T 11: 28,576,768 L280* probably null Het
Cd46 T G 1: 195,068,170 probably null Het
Cmklr1 C G 5: 113,614,929 D4H possibly damaging Het
Dnaaf3 T C 7: 4,523,865 probably null Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Eif2ak1 A G 5: 143,897,163 probably null Het
Erich4 A G 7: 25,615,239 M83T probably benign Het
Fbxo24 C T 5: 137,618,832 G331E possibly damaging Het
Fzd4 A G 7: 89,407,407 I221V probably benign Het
G6pc2 T C 2: 69,226,577 V189A probably damaging Het
Gm10663 A C 8: 65,075,034 E1A probably null Het
Gm4871 C A 5: 145,030,389 E178D probably damaging Het
Igdcc3 A G 9: 65,181,584 E415G probably damaging Het
Kmt2a A T 9: 44,821,975 probably benign Het
Lcat T C 8: 105,939,664 K409E probably benign Het
Lrriq4 C A 3: 30,659,995 N497K probably benign Het
Mical2 A G 7: 112,320,635 T451A probably damaging Het
Noxo1 C T 17: 24,698,317 probably benign Het
Oas1a A G 5: 120,907,427 I17T probably damaging Het
Otog A T 7: 46,288,768 Y1967F probably benign Het
Pcdha9 A T 18: 36,999,650 N591Y probably damaging Het
Plxna4 A G 6: 32,517,283 Y133H probably damaging Het
Pou5f2 T C 13: 78,024,999 L20P probably benign Het
Prkcb T A 7: 122,600,725 C586* probably null Het
Sema3b A T 9: 107,600,962 M408K probably damaging Het
Serpinf2 G A 11: 75,433,205 T332I probably damaging Het
Tmbim1 A G 1: 74,293,005 V121A probably benign Het
Tph2 C T 10: 115,119,874 G338D probably damaging Het
Trpc2 GTGTCCTA GTGTCCTATGTCCTA 7: 102,095,213 probably null Het
Ttn C T 2: 76,812,552 V13247M probably damaging Het
Uty C T Y: 1,174,825 G192R probably damaging Het
Vmn2r65 G T 7: 84,946,321 P385Q possibly damaging Het
Wdfy3 G A 5: 101,836,274 R3489W probably damaging Het
Zfp750 A G 11: 121,513,732 S106P probably benign Het
Other mutations in Krba1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00584:Krba1 APN 6 48406318 missense possibly damaging 0.95
IGL01663:Krba1 APN 6 48411754 missense probably damaging 0.99
IGL01764:Krba1 APN 6 48415836 missense probably benign 0.01
IGL02036:Krba1 APN 6 48415642 missense possibly damaging 0.95
IGL02333:Krba1 APN 6 48413087 missense probably damaging 0.99
IGL02681:Krba1 APN 6 48404118 missense probably damaging 1.00
IGL03069:Krba1 APN 6 48414549 missense possibly damaging 0.53
IGL03380:Krba1 APN 6 48403453 missense possibly damaging 0.53
PIT4151001:Krba1 UTSW 6 48402897 missense probably damaging 0.99
R0077:Krba1 UTSW 6 48405225 splice site probably benign
R0504:Krba1 UTSW 6 48416254 missense probably benign 0.07
R1051:Krba1 UTSW 6 48413398 missense possibly damaging 0.82
R1875:Krba1 UTSW 6 48414049 splice site probably null
R1912:Krba1 UTSW 6 48415765 missense probably benign 0.45
R2084:Krba1 UTSW 6 48414568 missense probably damaging 1.00
R4035:Krba1 UTSW 6 48411680 missense probably damaging 1.00
R4291:Krba1 UTSW 6 48415665 missense possibly damaging 0.93
R4568:Krba1 UTSW 6 48409723 missense probably damaging 0.98
R4619:Krba1 UTSW 6 48406348 nonsense probably null
R4638:Krba1 UTSW 6 48409751 nonsense probably null
R4913:Krba1 UTSW 6 48406957 missense probably benign 0.00
R5174:Krba1 UTSW 6 48412295 missense probably damaging 1.00
R5496:Krba1 UTSW 6 48406356 missense possibly damaging 0.54
R5514:Krba1 UTSW 6 48413495 missense probably damaging 1.00
R5879:Krba1 UTSW 6 48415744 missense possibly damaging 0.89
R6351:Krba1 UTSW 6 48414128 missense probably benign 0.35
R6516:Krba1 UTSW 6 48413272 nonsense probably null
R7003:Krba1 UTSW 6 48413080 missense possibly damaging 0.71
R7135:Krba1 UTSW 6 48416299 missense probably benign 0.01
R7202:Krba1 UTSW 6 48412327 missense probably damaging 1.00
R7308:Krba1 UTSW 6 48406339 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TGAGATCTACTGGGCAAGAAC -3'
(R):5'- TGAGCTGTTCCTGTACCCAG -3'

Sequencing Primer
(F):5'- GGCAAGAACCCTCCTAAGTC -3'
(R):5'- AGCAGGTCCCAGAAGCTG -3'
Posted On2016-10-05