Incidental Mutation 'R5487:Dnaaf3'
ID430408
Institutional Source Beutler Lab
Gene Symbol Dnaaf3
Ensembl Gene ENSMUSG00000055809
Gene Namedynein, axonemal assembly factor 3
Synonyms
MMRRC Submission 043048-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.336) question?
Stock #R5487 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location4522933-4532453 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 4523865 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000092498 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094897] [ENSMUST00000098859] [ENSMUST00000140424] [ENSMUST00000154913] [ENSMUST00000209148]
Predicted Effect probably null
Transcript: ENSMUST00000094897
SMART Domains Protein: ENSMUSP00000092498
Gene: ENSMUSG00000055809

DomainStartEndE-ValueType
Pfam:DUF4470 16 122 1.3e-27 PFAM
Pfam:DUF4471 154 436 5.3e-104 PFAM
internal_repeat_1 467 512 1.63e-5 PROSPERO
internal_repeat_1 525 568 1.63e-5 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000098859
SMART Domains Protein: ENSMUSP00000096458
Gene: ENSMUSG00000035458

DomainStartEndE-ValueType
Pfam:Troponin-I_N 1 32 1e-10 PFAM
Pfam:Troponin 47 178 3.6e-45 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123390
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126873
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127736
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132621
Predicted Effect probably benign
Transcript: ENSMUST00000140424
SMART Domains Protein: ENSMUSP00000115015
Gene: ENSMUSG00000035458

DomainStartEndE-ValueType
Pfam:Troponin-I_N 1 32 1.1e-14 PFAM
Pfam:Troponin 47 125 3e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150166
Predicted Effect probably benign
Transcript: ENSMUST00000154913
SMART Domains Protein: ENSMUSP00000122916
Gene: ENSMUSG00000035458

DomainStartEndE-ValueType
Pfam:Troponin-I_N 1 32 9e-15 PFAM
Pfam:Troponin 47 112 1.8e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205662
Predicted Effect probably benign
Transcript: ENSMUST00000209148
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.1%
  • 10x: 94.6%
  • 20x: 89.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is required for the assembly of axonemal inner and outer dynein arms and plays a role in assembling dynein complexes for transport into cilia. Defects in this gene are a cause of primary ciliary dyskinesia type 2 (CILD2). Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2012]
PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit situs inversus totalis and complex congenital heart disease associated with heterotaxy, abdominal organ situs anomalies and immotile respiratory cilia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b A G 11: 109,953,514 V959A probably damaging Het
AI314180 T C 4: 58,809,421 D1651G probably benign Het
Alg3 A T 16: 20,607,780 I115N probably damaging Het
Ash1l A G 3: 88,981,426 D204G probably benign Het
Camta1 C A 4: 151,144,754 E540D possibly damaging Het
Cblc T C 7: 19,784,808 T413A probably benign Het
Ccdc122 T A 14: 77,091,679 H57Q probably benign Het
Ccdc85a A T 11: 28,576,768 L280* probably null Het
Cd46 T G 1: 195,068,170 probably null Het
Cmklr1 C G 5: 113,614,929 D4H possibly damaging Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Eif2ak1 A G 5: 143,897,163 probably null Het
Erich4 A G 7: 25,615,239 M83T probably benign Het
Fbxo24 C T 5: 137,618,832 G331E possibly damaging Het
Fzd4 A G 7: 89,407,407 I221V probably benign Het
G6pc2 T C 2: 69,226,577 V189A probably damaging Het
Gm10663 A C 8: 65,075,034 E1A probably null Het
Gm4871 C A 5: 145,030,389 E178D probably damaging Het
Igdcc3 A G 9: 65,181,584 E415G probably damaging Het
Kmt2a A T 9: 44,821,975 probably benign Het
Krba1 T C 6: 48,404,039 V103A probably damaging Het
Lcat T C 8: 105,939,664 K409E probably benign Het
Lrriq4 C A 3: 30,659,995 N497K probably benign Het
Mical2 A G 7: 112,320,635 T451A probably damaging Het
Noxo1 C T 17: 24,698,317 probably benign Het
Oas1a A G 5: 120,907,427 I17T probably damaging Het
Otog A T 7: 46,288,768 Y1967F probably benign Het
Pcdha9 A T 18: 36,999,650 N591Y probably damaging Het
Plxna4 A G 6: 32,517,283 Y133H probably damaging Het
Pou5f2 T C 13: 78,024,999 L20P probably benign Het
Prkcb T A 7: 122,600,725 C586* probably null Het
Sema3b A T 9: 107,600,962 M408K probably damaging Het
Serpinf2 G A 11: 75,433,205 T332I probably damaging Het
Tmbim1 A G 1: 74,293,005 V121A probably benign Het
Tph2 C T 10: 115,119,874 G338D probably damaging Het
Trpc2 GTGTCCTA GTGTCCTATGTCCTA 7: 102,095,213 probably null Het
Ttn C T 2: 76,812,552 V13247M probably damaging Het
Uty C T Y: 1,174,825 G192R probably damaging Het
Vmn2r65 G T 7: 84,946,321 P385Q possibly damaging Het
Wdfy3 G A 5: 101,836,274 R3489W probably damaging Het
Zfp750 A G 11: 121,513,732 S106P probably benign Het
Other mutations in Dnaaf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02197:Dnaaf3 APN 7 4527497 missense probably damaging 1.00
IGL02319:Dnaaf3 APN 7 4523947 missense probably damaging 1.00
IGL02805:Dnaaf3 APN 7 4523705 missense possibly damaging 0.64
R1818:Dnaaf3 UTSW 7 4523569 unclassified probably null
R1818:Dnaaf3 UTSW 7 4523570 missense probably benign 0.35
R2063:Dnaaf3 UTSW 7 4523799 missense possibly damaging 0.87
R2064:Dnaaf3 UTSW 7 4523799 missense possibly damaging 0.87
R2066:Dnaaf3 UTSW 7 4523799 missense possibly damaging 0.87
R2068:Dnaaf3 UTSW 7 4523799 missense possibly damaging 0.87
R2132:Dnaaf3 UTSW 7 4523801 missense probably benign 0.00
R2363:Dnaaf3 UTSW 7 4532277 critical splice acceptor site probably null
R4710:Dnaaf3 UTSW 7 4526494 missense probably damaging 1.00
R4803:Dnaaf3 UTSW 7 4526904 missense probably benign 0.14
R4939:Dnaaf3 UTSW 7 4527145 missense probably damaging 1.00
R5846:Dnaaf3 UTSW 7 4523687 missense possibly damaging 0.73
R6084:Dnaaf3 UTSW 7 4524213 missense probably benign 0.00
R6218:Dnaaf3 UTSW 7 4523672 missense probably benign 0.23
R6576:Dnaaf3 UTSW 7 4523380 missense probably benign 0.41
R6916:Dnaaf3 UTSW 7 4527533 missense probably damaging 1.00
R7219:Dnaaf3 UTSW 7 4528077 missense probably damaging 1.00
Z1088:Dnaaf3 UTSW 7 4523795 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCAGATTCCACAGCTGAGTC -3'
(R):5'- AAGCTTTGCAGTCTCCATCCTG -3'

Sequencing Primer
(F):5'- ATTCCACAGCTGAGTCTCCGC -3'
(R):5'- ACCTGTGTATCTCAGCTCCTAG -3'
Posted On2016-10-05